Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4377
Trapped Gene
2310022B05Rik (ENSMUSG00000031983)
Vector Insertion
Chr 8: 127175322 - 127186747
Public Clones AE0888 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000366650 (Chr8:127186748..127187269 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAGGACGAAATCATCGAC Chr8:127186871..127186890 60.23 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000366650 (Chr8:127186748..127187269 -)
Downstram Exon
ENSMUSE00000215445 (Chr8:127175271..127175321 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAGGACGAAATCATCGAC Chr8:127186871..127186890 60.23 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000366650 Chr8:127186748..127187269 AGCAGGACGAAATCATCGAC Chr8:127186871..127186890 60.23 50

*** Putative Vector Insertion (Chr 8: 127175322 - 127186747) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215445 Chr8:127175271..127175321 No primer for this exon
downstream ENSMUSE00000215447 Chr8:127162991..127163515 GACTTGATCTGGCTGGGTGT Chr8:127163231..127163250 60.12 55
downstream ENSMUSE00000337827 Chr8:127159666..127161864 GTGCGGAAAGATGACTCCAT Chr8:127160419..127160438 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr8:127177677..127177697 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGACGTGACTGGGAAAACC Chr8:127177680..127177700 63.92 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031983