Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4380
Trapped Gene
5830415L20Rik (ENSMUSG00000058503)
Vector Insertion
Chr 5: 3557823 - 3558472
Public Clones AE0719 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000184909 (Chr5:3557744..3557822 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCTTTGGCTGAGTTTGAA Chr5:3557788..3557807 59.99 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000184909 (Chr5:3557744..3557822 +)
Downstram Exon
ENSMUSE00000184908 (Chr5:3558473..3558547 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCTTTGGCTGAGTTTGAA Chr5:3557788..3557807 59.99 45 TGGATGAGCTCTCATTTCCAC Chr5:3558538..3558558 60.21 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000656308 Chr5:3543833..3543947 No primer for this exon
upstream ENSMUSE00000703270 Chr5:3554316..3554335 No primer for this exon
upstream ENSMUSE00000703269 Chr5:3554638..3554736 CAATAGCAATGGCTCGATCA Chr5:3554652..3554671 59.79 45
upstream ENSMUSE00000184905 Chr5:3554639..3554736 CAATAGCAATGGCTCGATCA Chr5:3554652..3554671 59.79 45
upstream ENSMUSE00000184909 Chr5:3557744..3557822 AGGCTTTGGCTGAGTTTGAA Chr5:3557788..3557807 59.99 45

*** Putative Vector Insertion (Chr 5: 3557823 - 3558472) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000184908 Chr5:3558473..3558547 TGGATGAGCTCTCATTTCCAC Chr5:3558538..3558558 60.21 47.62
downstream ENSMUSE00000496161 Chr5:3558661..3558693 No primer for this exon
downstream ENSMUSE00000497715 Chr5:3559097..3559159 TTCGGAATCTGAAGAACTGCT Chr5:3559155..3559175 59.07 42.86
downstream ENSMUSE00000720344 Chr5:3559606..3559698 TTATGGCAACGGCTCTTCTT Chr5:3559658..3559677 59.85 45
downstream ENSMUSE00000721940 Chr5:3559606..3559698 TTATGGCAACGGCTCTTCTT Chr5:3559658..3559677 59.85 45
downstream ENSMUSE00000405924 Chr5:3561039..3561089 No primer for this exon
downstream ENSMUSE00000703264 Chr5:3561039..3561089 No primer for this exon
downstream ENSMUSE00000365015 Chr5:3564241..3564327 CAGCGACTCAGATGACAACG Chr5:3564309..3564328 60.62 55
downstream ENSMUSE00000703262 Chr5:3564241..3564327 CAGCGACTCAGATGACAACG Chr5:3564309..3564328 60.62 55
downstream ENSMUSE00000405213 Chr5:3565703..3565750 No primer for this exon
downstream ENSMUSE00000703260 Chr5:3565703..3565750 No primer for this exon
downstream ENSMUSE00000656303 Chr5:3568987..3570548 CAGAGTCACCAAGCACTGGA Chr5:3569285..3569304 60.02 55
downstream ENSMUSE00000703257 Chr5:3568987..3569810 CAGAGTCACCAAGCACTGGA Chr5:3569285..3569304 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTTTGGCTGAGTTTGAAG Chr5:3557790..3557810 59.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTTGGCTGAGTTTGAAG Chr5:3557790..3557810 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058503