Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4389
Trapped Gene
Cirh1a (ENSMUSG00000041438)
Vector Insertion
Chr 8: 109442706 - 109446071
Public Clones AE0491 (sanger) IST10194A4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000329844 (Chr8:109442520..109442705 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCCAAGAGACCAATGCAC Chr8:109442638..109442657 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000329844 (Chr8:109442520..109442705 +)
Downstram Exon
ENSMUSE00000329810 (Chr8:109446072..109446182 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCCAAGAGACCAATGCAC Chr8:109442638..109442657 59.93 50 TCATTTTTCGGAGGAAGTGG Chr8:109446127..109446146 60.04 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634542 Chr8:109417534..109417569 No primer for this exon
upstream ENSMUSE00000634541 Chr8:109417572..109417608 No primer for this exon
upstream ENSMUSE00000447964 Chr8:109417590..109417612 No primer for this exon
upstream ENSMUSE00000634539 Chr8:109418488..109418549 GGGTGAATTTAAGGTCCATCG Chr8:109418495..109418515 60.55 47.62
upstream ENSMUSE00000447951 Chr8:109418491..109418651 CATCAGGTATCCGGTGTGTG Chr8:109418539..109418558 59.83 55
upstream ENSMUSE00000514199 Chr8:109421960..109422151 TGGACTGAACGGAGAAATCC Chr8:109422031..109422050 60.05 50
upstream ENSMUSE00000517277 Chr8:109422342..109422426 TGAAGATGGCTCCGTGAAAC Chr8:109422350..109422369 61.19 50
upstream ENSMUSE00000337709 Chr8:109424746..109424835 GTCGCAGCTGGTTCCTTAGA Chr8:109424787..109424806 60.54 55
upstream ENSMUSE00000383129 Chr8:109428133..109428344 ATAGGCAACACCTGGGAGTG Chr8:109428160..109428179 59.99 55
upstream ENSMUSE00000329996 Chr8:109430025..109430196 AGCTGGTGTCCATGACTTCC Chr8:109430077..109430096 60.12 55
upstream ENSMUSE00000380591 Chr8:109430290..109430381 GCTGCTCTCCGAAAGATCAC Chr8:109430352..109430371 60.1 55
upstream ENSMUSE00000394164 Chr8:109432105..109432201 GCATCACTTGGAACTGTGGA Chr8:109432158..109432177 59.68 50
upstream ENSMUSE00000356226 Chr8:109434842..109434906 GCAGATCATCTCCTGCACCT Chr8:109434877..109434896 60.38 55
upstream ENSMUSE00000362234 Chr8:109436126..109436248 No primer for this exon
upstream ENSMUSE00000390288 Chr8:109437248..109437404 TTCATCTGTCGGAAGGAAGC Chr8:109437351..109437370 60.34 50
upstream ENSMUSE00000344388 Chr8:109440056..109440162 TTTGGCAGTCAGTCCAGATG Chr8:109440078..109440097 59.83 50
upstream ENSMUSE00000329875 Chr8:109441482..109441577 GCACAGTGCCTGCTTACAAC Chr8:109441489..109441508 59.52 55
upstream ENSMUSE00000329844 Chr8:109442520..109442705 ATCCCAAGAGACCAATGCAC Chr8:109442638..109442657 59.93 50

*** Putative Vector Insertion (Chr 8: 109442706 - 109446071) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000329810 Chr8:109446072..109446182 TCATTTTTCGGAGGAAGTGG Chr8:109446127..109446146 60.04 45
downstream ENSMUSE00000394911 Chr8:109446765..109446987 GGTGGGAGTTGAGCAATGAT Chr8:109446853..109446872 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTCCTCCATGATGCCTAC Chr8:109442660..109442680 60.03 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTCCTCCATGATGCCTAC Chr8:109442660..109442680 60.03 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041438