Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4392
Trapped Gene
Mbnl1 (ENSMUSG00000027763)
Vector Insertion
Chr 3: 60333727 - 60399515
Public Clones AE0478 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000413577 (Chr3:60332678..60333726 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTTGCTCACGACCAGACA Chr3:60333627..60333646 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000413577 (Chr3:60332678..60333726 +)
Downstram Exon
ENSMUSE00000172815 (Chr3:60399516..60399686 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTTGCTCACGACCAGACA Chr3:60333627..60333646 60.03 55 TTTTTAAGTGTGGGGGTGGA Chr3:60399573..60399592 60.2 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000495732 Chr3:60305174..60305345 No primer for this exon
upstream ENSMUSE00000413577 Chr3:60332678..60333726 GACTTGCTCACGACCAGACA Chr3:60333627..60333646 60.03 55

*** Putative Vector Insertion (Chr 3: 60333727 - 60399515) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000172815 Chr3:60399516..60399686 TTTTTAAGTGTGGGGGTGGA Chr3:60399573..60399592 60.2 45
downstream ENSMUSE00000172817 Chr3:60407616..60407816 TAAAGGCTGCTGATGCACTG Chr3:60407670..60407689 60.16 50
downstream ENSMUSE00000172818 Chr3:60417185..60417442 GATGAGCAAACCGACAGTCA Chr3:60417251..60417270 59.84 50
downstream ENSMUSE00000172816 Chr3:60419542..60419695 TGGGGGAAGTACAGCTTGAG Chr3:60419571..60419590 60.25 55
downstream ENSMUSE00000172814 Chr3:60425345..60425380 AACACTTGTAGCGGGTGTCA Chr3:60425382..60425401 59.21 50
downstream ENSMUSE00000568066 Chr3:60426068..60426162 AGGGAACACTTGTGGCAGAT Chr3:60426139..60426158 59.58 50
downstream ENSMUSE00000373694 Chr3:60429046..60429120 CTTGTGGCTAGTCAGATGTTCG Chr3:60429085..60429106 59.94 50
downstream ENSMUSE00000591274 Chr3:60429046..60429120 CTTGTGGCTAGTCAGATGTTCG Chr3:60429085..60429106 59.94 50
downstream ENSMUSE00000339886 Chr3:60430302..60433670 GCGACGTGTTTGAAGGGTAT Chr3:60432880..60432899 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr3:60375777..60375797 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCACGTGACTGGGAAAACC Chr3:60342774..60342794 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027763