Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4411
Trapped Gene
Gsk3b (ENSMUSG00000022812)
Vector Insertion
Chr 16: 38170834 - 38184520
Public Clones AD0762 (sanger) CMHD-GT_430D8-3 (cmhd) CMHD-GT_310A10-3 (cmhd) IST14810B7 (tigm)
IST12553H11 (tigm) IST14866F6 (tigm) IST13024G10 (tigm)
Private Clones OST470247 (lexicon) OST457913 (lexicon) OST457541 (lexicon) OST381800 (lexicon)
OST355851 (lexicon) OST325580 (lexicon) OST215812 (lexicon) OST66461 (lexicon)
OST56209 (lexicon) OST49112 (lexicon) OST16947 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000130676 (Chr16:38170750..38170833 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCGACTGCGGTATTTCTTC Chr16:38170796..38170815 60.21 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000130676 (Chr16:38170750..38170833 +)
Downstram Exon
ENSMUSE00000130687 (Chr16:38184521..38184631 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCGACTGCGGTATTTCTTC Chr16:38170796..38170815 60.21 50 AGTGTCTGCTTGGCTCGACT Chr16:38184615..38184634 60.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436954 Chr16:38089610..38090699 CTTGCGGGAGAACTTAATGC Chr16:38090505..38090524 59.85 50
upstream ENSMUSE00000700452 Chr16:38090374..38090699 CTTGCGGGAGAACTTAATGC Chr16:38090505..38090524 59.85 50
upstream ENSMUSE00000436937 Chr16:38144346..38144539 GATGGCAGCAAGGTAACCAC Chr16:38144354..38144373 60.53 55
upstream ENSMUSE00000130676 Chr16:38170750..38170833 TCCGACTGCGGTATTTCTTC Chr16:38170796..38170815 60.21 50

*** Putative Vector Insertion (Chr 16: 38170834 - 38184520) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000130687 Chr16:38184521..38184631 AGTGTCTGCTTGGCTCGACT Chr16:38184615..38184634 60.21 55
downstream ENSMUSE00000130691 Chr16:38187897..38188027 ATGTCTCGATGGCAGATTCC Chr16:38187967..38187986 60.04 50
downstream ENSMUSE00000130685 Chr16:38191614..38191720 GGTGCCCTGTAGTACCGAGA Chr16:38191682..38191701 60.13 60
downstream ENSMUSE00000436470 Chr16:38193983..38194080 CCAACTGATCCACACCACTG Chr16:38194069..38194088 60 55
downstream ENSMUSE00000475152 Chr16:38208081..38208176 AATTTGCTCCCTTGTTGGTG Chr16:38208113..38208132 59.97 45
downstream ENSMUSE00000700451 Chr16:38217199..38217237 AATGTCCTGCTCCTGGTGAG Chr16:38217223..38217242 60.26 55
downstream ENSMUSE00000436458 Chr16:38220058..38220244 CGCAATTCATCGAAAAATGA Chr16:38220182..38220201 59.64 35
downstream ENSMUSE00000436452 Chr16:38228764..38228862 GAGCATGTGGAGGGATAAGG Chr16:38228817..38228836 59.51 55
downstream ENSMUSE00000436942 Chr16:38240588..38241236 ATTGGTCTGTCCACGGTCTC Chr16:38240622..38240641 59.97 55
downstream ENSMUSE00000700450 Chr16:38240588..38240865 ATTGGTCTGTCCACGGTCTC Chr16:38240622..38240641 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGAATAACCTCCCCCTAA Chr16:38173868..38173888 60.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTGGCTTGGATATTTCTT Chr16:38173787..38173807 58.28 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022812