Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI443
Trapped Gene
Psma3 (ENSMUSG00000060073)
Vector Insertion
Chr 12: 72075755 - 72079719
Public Clones (sanger) DC0466 (sanger) (sanger) (sanger) CJ0047 (sanger) (sanger)
(sanger) AD0145 (sanger) (sanger) P099G03 (ggtc) M119D08 (ggtc)
D003G03 (ggtc) P124F12 (ggtc) D003G03 (ggtc) PST22218-NL (escells)
Private Clones OST454873 (lexicon) OST321144 (lexicon) OST315412 (lexicon) OST308485 (lexicon)
OST277276 (lexicon) OST217005 (lexicon) OST208380 (lexicon) OST190041 (lexicon)
OST178000 (lexicon) OST173435 (lexicon) OST151310 (lexicon) OST142610 (lexicon)
OST138148 (lexicon) OST137049 (lexicon) OST136796 (lexicon) OST77433 (lexicon)
OST77108 (lexicon) OST64930 (lexicon) OST41495 (lexicon) OST40050 (lexicon)
OST30579 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000114394 (Chr12:72075720..72075754 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000114394 (Chr12:72075720..72075754 +)
Downstram Exon
ENSMUSE00000464712 (Chr12:72079720..72079802 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGCCTTCATGGCATATTCA Chr12:72079792..72079811 59.65 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000114394 Chr12:72075720..72075754 No primer for this exon

*** Putative Vector Insertion (Chr 12: 72075755 - 72079719) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000464712 Chr12:72079720..72079802 CAGCCTTCATGGCATATTCA Chr12:72079792..72079811 59.65 45
downstream ENSMUSE00000511639 Chr12:72084306..72084429 CCCCAAACACAACACCATCT Chr12:72084352..72084371 60.67 50
downstream ENSMUSE00000510723 Chr12:72085480..72085581 No primer for this exon
downstream ENSMUSE00000508707 Chr12:72085659..72085732 TGCAGCCAAAAGGTCTAACA Chr12:72085734..72085753 59.46 45
downstream ENSMUSE00000514885 Chr12:72087850..72087922 CACCTGATGGGTCGATCATA Chr12:72087917..72087936 59.32 50
downstream ENSMUSE00000513773 Chr12:72089411..72089476 No primer for this exon
downstream ENSMUSE00000503468 Chr12:72091472..72091518 ATCACGGCAAGTCATTTCCT Chr12:72091498..72091517 59.56 45
downstream ENSMUSE00000502608 Chr12:72094000..72094067 CAGCTGAGCTCCAGTTCAAA Chr12:72094059..72094078 59.31 50
downstream ENSMUSE00000499551 Chr12:72094493..72094557 CTTGGCATATTTCTCTGCTTCC Chr12:72094558..72094579 60.22 45.46
downstream ENSMUSE00000500549 Chr12:72095338..72095492 TGAAAATCGGTCAGTGGGTA Chr12:72095475..72095494 58.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGTGAGGTAATCGCCTTG Chr12:72078797..72078817 60.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTCCAGTTCGGGGTTGAA Chr12:72075776..72075796 62.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060073