Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4440
Trapped Gene
Ccnt1 (ENSMUSG00000011960)
Vector Insertion
Chr 15: 98390757 - 98395477
Public Clones AC0583 (sanger) (egtc)
Private Clones OST365633 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000132453 (Chr15:98395478..98395559 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000132453 (Chr15:98395478..98395559 -)
Downstram Exon
ENSMUSE00000132454 (Chr15:98390628..98390756 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679188 Chr15:98401302..98401354 No primer for this exon
upstream ENSMUSE00000368014 Chr15:98397907..98398714 No primer for this exon
upstream ENSMUSE00000132453 Chr15:98395478..98395559 No primer for this exon

*** Putative Vector Insertion (Chr 15: 98390757 - 98395477) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000132454 Chr15:98390628..98390756 No primer for this exon
downstream ENSMUSE00000132447 Chr15:98385032..98385092 No primer for this exon
downstream ENSMUSE00000132446 Chr15:98382345..98382407 No primer for this exon
downstream ENSMUSE00000132451 Chr15:98379097..98379142 No primer for this exon
downstream ENSMUSE00000132450 Chr15:98377176..98377339 No primer for this exon
downstream ENSMUSE00000270648 Chr15:98376955..98377025 No primer for this exon
downstream ENSMUSE00000270638 Chr15:98373642..98375039 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAAATCCCTTTGGGTTTG Chr15:98395437..98395457 59.26 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAAATCCCTTTGGGTTTG Chr15:98395437..98395457 59.26 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000011960