Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4448
Trapped Gene
Dnajc13 (ENSMUSG00000032560)
Vector Insertion
Chr 9: 104073145 - 104074850
Public Clones AC0192 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220819 (Chr9:104074851..104074942 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCATGGAGCTGGTCAAGT Chr9:104074870..104074889 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220819 (Chr9:104074851..104074942 -)
Downstram Exon
ENSMUSE00000352070 (Chr9:104073045..104073144 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCATGGAGCTGGTCAAGT Chr9:104074870..104074889 60.12 55 CAAAACCATGGATTCTGCAA Chr9:104073060..104073079 59.52 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000220814 Chr9:104089878..104089987 CTTGACGCTTGGAAGAAGGA Chr9:104089953..104089972 60.51 50
upstream ENSMUSE00000220843 Chr9:104089041..104089119 GGATAAGAACCCGGAAGGAA Chr9:104089043..104089062 60.26 50
upstream ENSMUSE00000220817 Chr9:104086913..104087048 CCTTTTCAACCGCCATAAAG Chr9:104086916..104086935 59.58 45
upstream ENSMUSE00000220841 Chr9:104084835..104085019 CTGGCTTTCCACACAGTCAA Chr9:104084884..104084903 59.87 50
upstream ENSMUSE00000220827 Chr9:104084358..104084432 CCTGAATCGCTCCAGTAAGC Chr9:104084378..104084397 59.98 55
upstream ENSMUSE00000220839 Chr9:104083329..104083448 TGGCATCATCAAGGACCTCT Chr9:104083352..104083371 60.62 50
upstream ENSMUSE00000220837 Chr9:104082399..104082578 GTGTCAGCTCTTTCGCTGTG Chr9:104082525..104082544 59.78 55
upstream ENSMUSE00000220847 Chr9:104081132..104081299 TTTAGCTGGCATGCTGACAC Chr9:104081173..104081192 60.02 50
upstream ENSMUSE00000220823 Chr9:104078988..104079101 AGAGCCCGTATTTGATGTGG Chr9:104079054..104079073 59.96 50
upstream ENSMUSE00000358814 Chr9:104077977..104078093 ACAGTGAACACGCCAAAGAA Chr9:104078037..104078056 59.34 45
upstream ENSMUSE00000220820 Chr9:104076679..104076856 GACCGCTTACCAAGAGTGGA Chr9:104076723..104076742 60.26 55
upstream ENSMUSE00000220819 Chr9:104074851..104074942 GTCCATGGAGCTGGTCAAGT Chr9:104074870..104074889 60.12 55

*** Putative Vector Insertion (Chr 9: 104073145 - 104074850) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000352070 Chr9:104073045..104073144 CAAAACCATGGATTCTGCAA Chr9:104073060..104073079 59.52 40
downstream ENSMUSE00000316251 Chr9:104069744..104069818 TTTGCCATGGCTTCTTTGAT Chr9:104069724..104069743 60.58 40
downstream ENSMUSE00000387292 Chr9:104069301..104069413 GGGTGTGTTGAATTGCAGAA Chr9:104069346..104069365 59.55 45
downstream ENSMUSE00000220853 Chr9:104068024..104068193 AGCAGCTTCAGGGTTGTCTC Chr9:104068100..104068119 59.6 55
downstream ENSMUSE00000220832 Chr9:104067847..104067889 GGGTTGTCCCGTTGATTTTT Chr9:104067841..104067860 60.95 45
downstream ENSMUSE00000316163 Chr9:104067290..104067463 CAAGCTGGCTGTGCAATAAA Chr9:104067347..104067366 60.01 45
downstream ENSMUSE00000316144 Chr9:104064985..104065164 TGTGATTCATCGCCTGGATA Chr9:104065022..104065041 60.03 45
downstream ENSMUSE00000316126 Chr9:104064603..104064743 CTTTCGCATTCCATTCATCA Chr9:104064659..104064678 59.62 40
downstream ENSMUSE00000316103 Chr9:104062809..104062952 GCAGGACTGTCGAGGTTTTC Chr9:104062854..104062873 59.85 55
downstream ENSMUSE00000220824 Chr9:104059144..104059243 GGTCTTTGAAGGCACTCCAG Chr9:104059173..104059192 59.84 55
downstream ENSMUSE00000316064 Chr9:104053962..104054753 AAGACGGTCATGGAGACCTG Chr9:104054199..104054218 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAGCTGGCGTTAGAGGTA Chr9:104074846..104074866 60.18 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAGCTGGCGTTAGAGGTA Chr9:104074846..104074866 60.18 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032560