Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4459
Trapped Gene
Nf1 (ENSMUSG00000020716)
Vector Insertion
Chr 11: 79255477 - 79257270
Public Clones AA0320 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000108517 (Chr11:79255393..79255476 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000108517 (Chr11:79255393..79255476 +)
Downstram Exon
ENSMUSE00000108553 (Chr11:79257271..79257711 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000487904 Chr11:79153394..79153561 No primer for this exon
upstream ENSMUSE00000676109 Chr11:79197610..79197624 No primer for this exon
upstream ENSMUSE00000285114 Chr11:79197677..79197820 No primer for this exon
upstream ENSMUSE00000285107 Chr11:79200157..79200240 No primer for this exon
upstream ENSMUSE00000285099 Chr11:79203711..79203901 No primer for this exon
upstream ENSMUSE00000285096 Chr11:79209357..79209463 No primer for this exon
upstream ENSMUSE00000285091 Chr11:79221916..79221983 No primer for this exon
upstream ENSMUSE00000285086 Chr11:79222204..79222279 No primer for this exon
upstream ENSMUSE00000285079 Chr11:79222896..79223053 No primer for this exon
upstream ENSMUSE00000285071 Chr11:79224998..79225171 No primer for this exon
upstream ENSMUSE00000108516 Chr11:79225557..79225679 No primer for this exon
upstream ENSMUSE00000108549 Chr11:79226186..79226260 No primer for this exon
upstream ENSMUSE00000108501 Chr11:79232054..79232185 No primer for this exon
upstream ENSMUSE00000108514 Chr11:79239015..79239149 No primer for this exon
upstream ENSMUSE00000108506 Chr11:79242080..79242193 No primer for this exon
upstream ENSMUSE00000108503 Chr11:79248347..79248426 No primer for this exon
upstream ENSMUSE00000108524 Chr11:79250192..79250315 No primer for this exon
upstream ENSMUSE00000108556 Chr11:79252189..79252350 No primer for this exon
upstream ENSMUSE00000108554 Chr11:79254350..79254599 No primer for this exon
upstream ENSMUSE00000108519 Chr11:79255131..79255204 No primer for this exon
upstream ENSMUSE00000108517 Chr11:79255393..79255476 No primer for this exon

*** Putative Vector Insertion (Chr 11: 79255477 - 79257270) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000108553 Chr11:79257271..79257711 No primer for this exon
downstream ENSMUSE00000108499 Chr11:79258102..79258241 No primer for this exon
downstream ENSMUSE00000108507 Chr11:79258526..79258648 No primer for this exon
downstream ENSMUSE00000108526 Chr11:79259218..79259301 No primer for this exon
downstream ENSMUSE00000108531 Chr11:79260308..79260424 No primer for this exon
downstream ENSMUSE00000108559 Chr11:79260986..79261167 No primer for this exon
downstream ENSMUSE00000108525 Chr11:79261627..79261838 No primer for this exon
downstream ENSMUSE00000108510 Chr11:79267305..79267466 No primer for this exon
downstream ENSMUSE00000108563 Chr11:79267601..79267704 No primer for this exon
downstream ENSMUSE00000108536 Chr11:79272273..79272408 No primer for this exon
downstream ENSMUSE00000108508 Chr11:79276735..79276797 No primer for this exon
downstream ENSMUSE00000676108 Chr11:79281616..79281656 No primer for this exon
downstream ENSMUSE00000578202 Chr11:79282219..79282377 No primer for this exon
downstream ENSMUSE00000676107 Chr11:79282219..79282377 No primer for this exon
downstream ENSMUSE00000578201 Chr11:79283275..79283372 No primer for this exon
downstream ENSMUSE00000676106 Chr11:79283275..79283372 No primer for this exon
downstream ENSMUSE00000578200 Chr11:79284937..79285083 No primer for this exon
downstream ENSMUSE00000676105 Chr11:79284937..79285083 No primer for this exon
downstream ENSMUSE00000108500 Chr11:79286831..79286977 No primer for this exon
downstream ENSMUSE00000676104 Chr11:79286831..79286977 No primer for this exon
downstream ENSMUSE00000108505 Chr11:79289275..79289385 No primer for this exon
downstream ENSMUSE00000676103 Chr11:79289275..79289385 No primer for this exon
downstream ENSMUSE00000108509 Chr11:79349105..79349537 No primer for this exon
downstream ENSMUSE00000676102 Chr11:79349105..79349537 No primer for this exon
downstream ENSMUSE00000108548 Chr11:79350295..79350635 No primer for this exon
downstream ENSMUSE00000676101 Chr11:79350295..79350635 No primer for this exon
downstream ENSMUSE00000108527 Chr11:79353832..79354034 No primer for this exon
downstream ENSMUSE00000676100 Chr11:79353832..79354034 No primer for this exon
downstream ENSMUSE00000108497 Chr11:79358856..79359049 No primer for this exon
downstream ENSMUSE00000676099 Chr11:79358856..79359049 No primer for this exon
downstream ENSMUSE00000108558 Chr11:79359774..79359914 No primer for this exon
downstream ENSMUSE00000676098 Chr11:79359774..79359914 No primer for this exon
downstream ENSMUSE00000108546 Chr11:79360473..79360752 No primer for this exon
downstream ENSMUSE00000676097 Chr11:79360473..79360752 No primer for this exon
downstream ENSMUSE00000108562 Chr11:79361170..79361384 No primer for this exon
downstream ENSMUSE00000676096 Chr11:79361170..79361384 No primer for this exon
downstream ENSMUSE00000108541 Chr11:79361976..79362037 No primer for this exon
downstream ENSMUSE00000676095 Chr11:79361976..79362037 No primer for this exon
downstream ENSMUSE00000108544 Chr11:79362176..79362290 No primer for this exon
downstream ENSMUSE00000676094 Chr11:79362176..79362290 No primer for this exon
downstream ENSMUSE00000108560 Chr11:79362910..79363011 No primer for this exon
downstream ENSMUSE00000676093 Chr11:79362910..79363011 No primer for this exon
downstream ENSMUSE00000108512 Chr11:79364496..79364636 No primer for this exon
downstream ENSMUSE00000676092 Chr11:79364496..79364636 No primer for this exon
downstream ENSMUSE00000108551 Chr11:79367373..79367499 No primer for this exon
downstream ENSMUSE00000676091 Chr11:79367373..79367499 No primer for this exon
downstream ENSMUSE00000108561 Chr11:79368983..79369114 No primer for this exon
downstream ENSMUSE00000676090 Chr11:79368983..79369114 No primer for this exon
downstream ENSMUSE00000108557 Chr11:79370201..79370336 No primer for this exon
downstream ENSMUSE00000676088 Chr11:79370201..79370336 No primer for this exon
downstream ENSMUSE00000108518 Chr11:79372907..79373064 No primer for this exon
downstream ENSMUSE00000676087 Chr11:79372907..79373064 No primer for this exon
downstream ENSMUSE00000108532 Chr11:79378326..79378448 No primer for this exon
downstream ENSMUSE00000676086 Chr11:79378326..79378448 No primer for this exon
downstream ENSMUSE00000108540 Chr11:79378923..79379053 No primer for this exon
downstream ENSMUSE00000676085 Chr11:79378923..79379053 No primer for this exon
downstream ENSMUSE00000108504 Chr11:79379422..79379522 No primer for this exon
downstream ENSMUSE00000676084 Chr11:79379422..79379522 No primer for this exon
downstream ENSMUSE00000108528 Chr11:79382152..79382294 No primer for this exon
downstream ENSMUSE00000676083 Chr11:79382152..79382294 No primer for this exon
downstream ENSMUSE00000108538 Chr11:79382626..79382672 No primer for this exon
downstream ENSMUSE00000676082 Chr11:79382626..79382672 No primer for this exon
downstream ENSMUSE00000108511 Chr11:79383733..79383949 No primer for this exon
downstream ENSMUSE00000676081 Chr11:79383733..79383949 No primer for this exon
downstream ENSMUSE00000479017 Chr11:79391756..79395111 No primer for this exon
downstream ENSMUSE00000631689 Chr11:79391756..79395111 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATGGCCAGGTGAGTTGTT Chr11:79255468..79255488 59.58 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATGGCCAGGTGAGTTGTT Chr11:79255468..79255488 59.58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020716