Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4469
Trapped Gene
Dusp12 (ENSMUSG00000026659)
Vector Insertion
Chr 1: 172809790 - 172809978
Public Clones AA0067 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000506000 (Chr1:172809791..172809977 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTGTTGGGCGTTATGGAT Chr1:172809797..172809816 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000506000 (Chr1:172809791..172809977 -)
Downstram Exon
ENSMUSE00000514238 (Chr1:172809791..172809977 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTGTTGGGCGTTATGGAT Chr1:172809797..172809816 59.96 50 ATCCATAACGCCCAACAGAG Chr1:172809775..172809794 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000495810 Chr1:172815198..172815552 CTGACGGTGGACTCTGAACC Chr1:172815351..172815370 60.71 60
upstream ENSMUSE00000161686 Chr1:172811046..172811159 GTCAGTCGCAGTGTTGCTGT Chr1:172811130..172811149 60.1 55
upstream ENSMUSE00000161687 Chr1:172810704..172810822 CGATACGTCCAGTGCCTTTT Chr1:172810746..172810765 60.13 50
upstream ENSMUSE00000474519 Chr1:172810261..172810357 GGAACTCTTCGCTGTTGACC Chr1:172810319..172810338 59.85 55
upstream ENSMUSE00000515104 Chr1:172810261..172810357 GGAACTCTTCGCTGTTGACC Chr1:172810319..172810338 59.85 55
upstream ENSMUSE00000506000 Chr1:172809791..172809977 CTCTGTTGGGCGTTATGGAT Chr1:172809797..172809816 59.96 50
upstream ENSMUSE00000514238 Chr1:172809791..172809977 CTCTGTTGGGCGTTATGGAT Chr1:172809797..172809816 59.96 50

*** Putative Vector Insertion (Chr 1: 172809790 - 172809978) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000435073 Chr1:172804320..172804701 GGGTTATCCATCGACCACAG Chr1:172804598..172804617 60.19 55
downstream ENSMUSE00000593058 Chr1:172804320..172804701 GGGTTATCCATCGACCACAG Chr1:172804598..172804617 60.19 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGTTTTACAGGCGGTCTT Chr1:172809968..172809988 59.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGTTTTACAGGCGGTCTT Chr1:172809968..172809988 59.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026659