Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4478
Trapped Gene
Fcho2 (ENSMUSG00000041685)
Vector Insertion
Chr 13: 99585030 - 99585102
Public Clones AH0519 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680188 (Chr13:99585031..99585101 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680188 (Chr13:99585031..99585101 -)
Downstram Exon
ENSMUSE00000680157 (Chr13:99585031..99585404 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTCGCAAGGAATGGTACAGA Chr13:99585293..99585312 59.27 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680157 Chr13:99585031..99585404 TCTGTACCATTCCTTGCGAAC Chr13:99585314..99585334 60.12 47.62
upstream ENSMUSE00000680188 Chr13:99585031..99585101 No primer for this exon

*** Putative Vector Insertion (Chr 13: 99585030 - 99585102) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000569531 Chr13:99576261..99576352 AGTTGATATCTGTCCATGCTTCA Chr13:99576268..99576290 58.73 39.13
downstream ENSMUSE00000680187 Chr13:99576261..99576352 AGTTGATATCTGTCCATGCTTCA Chr13:99576268..99576290 58.73 39.13
downstream ENSMUSE00000295736 Chr13:99566248..99566322 TTGCTTGCAGATTTCGCTAGT Chr13:99566241..99566261 60.17 42.86
downstream ENSMUSE00000295735 Chr13:99559687..99559828 TACATCCCACATTGGTGCAA Chr13:99559782..99559801 60.79 45
downstream ENSMUSE00000295733 Chr13:99559318..99559470 TCCTTCGACTTCTGGAGTGC Chr13:99559369..99559388 60.53 55
downstream ENSMUSE00000295729 Chr13:99554731..99554835 TGGGCTGTTTCTGTCATCTTC Chr13:99554710..99554730 60.25 47.62
downstream ENSMUSE00000295725 Chr13:99547344..99547442 CTGGCCGATCTGTAAGTGGA Chr13:99547322..99547341 61.2 55
downstream ENSMUSE00000295720 Chr13:99545776..99545872 TTCCCTGTGCCTTTTGACTC Chr13:99545765..99545784 60.23 50
downstream ENSMUSE00000371377 Chr13:99534460..99534504 CAACTGCACTAGCAGGGTCA Chr13:99534441..99534460 60.05 55
downstream ENSMUSE00000404392 Chr13:99533645..99533717 CAGATTCTGCGTCCTTTTCC Chr13:99533624..99533643 59.81 50
downstream ENSMUSE00000353228 Chr13:99532787..99532811 AAGCGAATCTGCATCAGGAC Chr13:99532765..99532784 60.37 50
downstream ENSMUSE00000680158 Chr13:99525932..99525942 No primer for this exon
downstream ENSMUSE00000640331 Chr13:99525696..99525807 CAGCCTGGTCTGCATATTGA Chr13:99525729..99525748 59.82 50
downstream ENSMUSE00000386024 Chr13:99525521..99525580 TCATTCTGATTTGCTTCTGGTTT Chr13:99525500..99525522 60.12 34.78
downstream ENSMUSE00000364019 Chr13:99525035..99525208 AAGCCATTGTGTGATGCAAG Chr13:99525069..99525088 59.72 45
downstream ENSMUSE00000680155 Chr13:99523795..99523803 No primer for this exon
downstream ENSMUSE00000680162 Chr13:99522289..99522300 No primer for this exon
downstream ENSMUSE00000680161 Chr13:99521862..99521886 No primer for this exon
downstream ENSMUSE00000396727 Chr13:99519807..99519849 GGGTAGAGAAGACGGCTTTG Chr13:99519790..99519809 58.93 55
downstream ENSMUSE00000356068 Chr13:99518171..99518259 No primer for this exon
downstream ENSMUSE00000358561 Chr13:99515756..99515859 TGGAACAAGGGTGCCTAAAG Chr13:99515797..99515816 60.1 50
downstream ENSMUSE00000295689 Chr13:99513366..99513495 ACGAGGCAGACGAGGAGATA Chr13:99513371..99513390 59.97 55
downstream ENSMUSE00000295679 Chr13:99504974..99505085 GCGATTGCCACAGGTAAAGT Chr13:99505000..99505019 60.14 50
downstream ENSMUSE00000295670 Chr13:99502473..99502628 GTCACGTCTCCCGTGATCTT Chr13:99502577..99502596 60.12 55
downstream ENSMUSE00000295660 Chr13:99502032..99502164 GCAGCTGGATTTTGTTCTGA Chr13:99502044..99502063 59 45
downstream ENSMUSE00000295651 Chr13:99500732..99500931 GGGAACCACCACCTGTATGT Chr13:99500757..99500776 59.56 55
downstream ENSMUSE00000295639 Chr13:99500144..99500208 No primer for this exon
downstream ENSMUSE00000376985 Chr13:99496016..99496180 AGTGGCAAAGCGCTTCTTTA Chr13:99495995..99496014 60.15 45
downstream ENSMUSE00000680159 Chr13:99493369..99495731 CAGAGCTTGTCTGCTTCACG Chr13:99494608..99494627 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr13:99585031..99585051 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000041685