Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI448
Trapped Gene
Pip5k1a (ENSMUSG00000028126)
Vector Insertion
Chr 3: 94869342 - 94869366
Public Clones DC0148 (sanger) CSD327 (baygenomics) HMA542 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672466 (Chr3:94869343..94869365 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672466 (Chr3:94869343..94869365 -)
Downstram Exon
ENSMUSE00000176508 (Chr3:94869343..94869427 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGAACCGCTCAGCATAGAAG Chr3:94869360..94869379 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637777 Chr3:94910298..94910701 CTAGGAAGGTGCGAGACTGC Chr3:94910555..94910574 60.16 60
upstream ENSMUSE00000672453 Chr3:94910298..94910745 CTAGGAAGGTGCGAGACTGC Chr3:94910555..94910574 60.16 60
upstream ENSMUSE00000672462 Chr3:94910298..94910778 CTAGGAAGGTGCGAGACTGC Chr3:94910555..94910574 60.16 60
upstream ENSMUSE00000672473 Chr3:94910298..94910797 CTAGGAAGGTGCGAGACTGC Chr3:94910555..94910574 60.16 60
upstream ENSMUSE00000717182 Chr3:94910298..94910797 CTAGGAAGGTGCGAGACTGC Chr3:94910555..94910574 60.16 60
upstream ENSMUSE00000672452 Chr3:94900965..94901240 AAAGACGCTTCGGACAAGTG Chr3:94901127..94901146 60.43 50
upstream ENSMUSE00000566359 Chr3:94886713..94886750 CTGGAATCAAGAGAGCCACAG Chr3:94886721..94886741 60 52.38
upstream ENSMUSE00000672459 Chr3:94886713..94886744 CTGGAATCAAGAGAGCCACAG Chr3:94886721..94886741 60 52.38
upstream ENSMUSE00000672468 Chr3:94886713..94886747 CTGGAATCAAGAGAGCCACAG Chr3:94886721..94886741 60 52.38
upstream ENSMUSE00000672457 Chr3:94882412..94882438 No primer for this exon
upstream ENSMUSE00000255143 Chr3:94882024..94882104 AGGCCATCGAAGTGTTGATT Chr3:94882050..94882069 59.56 45
upstream ENSMUSE00000566368 Chr3:94877915..94878045 AACCAGAGCGTGATGTCCTC Chr3:94877956..94877975 60.27 55
upstream ENSMUSE00000566367 Chr3:94876325..94876442 TCAAGACCTATGCGCCTGTT Chr3:94876376..94876395 60.8 50
upstream ENSMUSE00000176504 Chr3:94875812..94875964 ACCGTCCAGCATAAAGAAGC Chr3:94875849..94875868 59.34 50
upstream ENSMUSE00000672467 Chr3:94874815..94874933 ATCTCTTGCCTCGGTCAGTC Chr3:94874817..94874836 59.41 55
upstream ENSMUSE00000672455 Chr3:94874748..94874869 ATCTCTTGCCTCGGTCAGTC Chr3:94874817..94874836 59.41 55
upstream ENSMUSE00000498372 Chr3:94874634..94874933 ATCCCTGACGGCCTATTTTT Chr3:94874686..94874705 59.8 45
upstream ENSMUSE00000176506 Chr3:94871983..94872188 GAAGGCGCTCTATTCCACAG Chr3:94872041..94872060 59.98 55
upstream ENSMUSE00000176502 Chr3:94871304..94871387 AGGAGAAAGGCTCCTGCTTT Chr3:94871338..94871357 59.6 50
upstream ENSMUSE00000176499 Chr3:94869734..94869782 TTGGAGCACTCTTGGAAAGC Chr3:94869750..94869769 60.52 50
upstream ENSMUSE00000176508 Chr3:94869343..94869427 CTTCTATGCTGAGCGGTTCC Chr3:94869382..94869401 59.98 55
upstream ENSMUSE00000672466 Chr3:94869343..94869365 No primer for this exon

*** Putative Vector Insertion (Chr 3: 94869342 - 94869366) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176497 Chr3:94868253..94868396 CTGATCGCCGAGAGAAAGAC Chr3:94868318..94868337 60.1 55
downstream ENSMUSE00000176495 Chr3:94867577..94867706 TCCAAAGGTGGAGTCTGAGG Chr3:94867636..94867655 60.23 55
downstream ENSMUSE00000176500 Chr3:94864406..94864451 TGGGTGAACTCTGACTCTGC Chr3:94864385..94864404 58.97 55
downstream ENSMUSE00000672469 Chr3:94862494..94864007 AGACAGTTACGTGGGGGTTG Chr3:94862773..94862792 59.88 55
downstream ENSMUSE00000672458 Chr3:94862491..94864007 AGACAGTTACGTGGGGGTTG Chr3:94862773..94862792 59.88 55
downstream ENSMUSE00000672460 Chr3:94862467..94864007 AGACAGTTACGTGGGGGTTG Chr3:94862773..94862792 59.88 55
downstream ENSMUSE00000672463 Chr3:94862452..94864007 AGACAGTTACGTGGGGGTTG Chr3:94862773..94862792 59.88 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCTATGCTGAGCGGTTCC Chr3:94869380..94869400 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCTATGCTGAGCGGTTCC Chr3:94869380..94869400 59.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028126