Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI451
Trapped Gene
Gab1 (ENSMUSG00000031714)
Vector Insertion
Chr 8: 83324295 - 83403430
Public Clones (sanger) DC0124 (sanger) YTC193 (baygenomics) D026A02 (ggtc) D048E07 (ggtc)
PST12387-NR (escells) PST23656-NL (escells) PST1642-1 (escells) PST17147-NL (escells)
IST11130E10 (tigm) IST12035E12 (tigm) IST12444H7 (tigm) IST14445D2 (tigm)
IST10343H8 (tigm) IST12035E12 (tigm) IST13663D3 (tigm) IST15054E5 (tigm)
IST11801B3 (tigm) IST12155G3 (tigm)
Private Clones OST463127 (lexicon) OST212031 (lexicon) OST175247 (lexicon) OST166466 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000387918 (Chr8:83403431..83404395 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGATCGAGTTCCTCTTCAG Chr8:83403688..83403707 59.94 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000387918 (Chr8:83403431..83404395 -)
Downstram Exon
ENSMUSE00000212304 (Chr8:83324000..83324294 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGATCGAGTTCCTCTTCAG Chr8:83403688..83403707 59.94 55 GCTTCTTGGCATGATCGTTT Chr8:83324179..83324198 60.22 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000387918 Chr8:83403431..83404395 CCGATCGAGTTCCTCTTCAG Chr8:83403688..83403707 59.94 55

*** Putative Vector Insertion (Chr 8: 83324295 - 83403430) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212304 Chr8:83324000..83324294 GCTTCTTGGCATGATCGTTT Chr8:83324179..83324198 60.22 45
downstream ENSMUSE00000212303 Chr8:83315288..83315513 AGGTAGCGCGACTGAAGAAG Chr8:83315382..83315401 59.78 55
downstream ENSMUSE00000284348 Chr8:83312389..83312993 GTTGGCGGAATGTCGTAACT Chr8:83312630..83312649 60 50
downstream ENSMUSE00000284325 Chr8:83309000..83309085 GGTCCGTGGAATATCATAGCA Chr8:83309026..83309046 59.8 47.62
downstream ENSMUSE00000284305 Chr8:83308526..83308829 CTCTTCACCCGAGACACCTC Chr8:83308763..83308782 59.83 60
downstream ENSMUSE00000284290 Chr8:83298833..83298926 GCAGCTCTTCCCATTCTGAC Chr8:83298854..83298873 59.96 55
downstream ENSMUSE00000284274 Chr8:83298449..83298572 TTCGCCAGACAGATTTGGAT Chr8:83298433..83298452 60.6 45
downstream ENSMUSE00000284251 Chr8:83293550..83293672 TTTATTCATCGGGCTGCTTC Chr8:83293600..83293619 60.17 45
downstream ENSMUSE00000341346 Chr8:83288339..83290386 ATCCACACCAGACGATGTCA Chr8:83288869..83288888 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGCTTAGTGAGGAACCAT Chr8:83397448..83397468 60.33 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAGGAAGGGGAGACCATA Chr8:83397407..83397427 59.92 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGTCTGCTTTAGTTTTGTTTCGTT Chr8:83398415..83398439 59.43 33.33 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCCTTCGTGACTGGGAAAAC Chr8:83398330..83398350 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031714