Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI452
Trapped Gene
Gnai3 (ENSMUSG00000000001)
Vector Insertion
Chr 3: 107926756 - 107948805
Public Clones DC0121 (sanger) YTA048 (baygenomics) CSH700 (baygenomics) YTA187 (baygenomics)
CSD244 (baygenomics) YTA473 (baygenomics) CSH696 (baygenomics) RRX057 (baygenomics)
W095F08 (ggtc)
Private Clones OST249171 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000334714 (Chr3:107948806..107949007 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000334714 (Chr3:107948806..107949007 -)
Downstram Exon
ENSMUSE00000276500 (Chr3:107926713..107926755 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000334714 Chr3:107948806..107949007 No primer for this exon

*** Putative Vector Insertion (Chr 3: 107926756 - 107948805) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000276500 Chr3:107926713..107926755 No primer for this exon
downstream ENSMUSE00000276490 Chr3:107926460..107926601 No primer for this exon
downstream ENSMUSE00000276482 Chr3:107921219..107921376 No primer for this exon
downstream ENSMUSE00000565003 Chr3:107918681..107918809 No primer for this exon
downstream ENSMUSE00000565001 Chr3:107915391..107915520 No primer for this exon
downstream ENSMUSE00000565000 Chr3:107914853..107915006 No primer for this exon
downstream ENSMUSE00000404895 Chr3:107912321..107912530 No primer for this exon
downstream ENSMUSE00000363317 Chr3:107910199..107912234 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCTGAAAACAAATCCTGTG Chr3:107948762..107948782 59.32 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGGCGTGACTGGGAAAAC Chr3:107948739..107948759 62.79 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000001