Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI453
Trapped Gene
D6Wsu163e (ENSMUSG00000030347)
Vector Insertion
Chr 6: 126892525 - 126894809
Public Clones DC0117 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000240276 (Chr6:126892330..126892524 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCGAGAAAGGTTCTGCAA Chr6:126892356..126892375 59.85 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000240276 (Chr6:126892330..126892524 +)
Downstram Exon
ENSMUSE00000240270 (Chr6:126894810..126894955 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCGAGAAAGGTTCTGCAA Chr6:126892356..126892375 59.85 45 ATAAACCGGCTCAGAGCATC Chr6:126894840..126894859 59.3 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000439593 Chr6:126889984..126890044 CAGTTCTGCGTTGACAGCTC Chr6:126889996..126890015 59.78 55
upstream ENSMUSE00000240276 Chr6:126892330..126892524 AACCGAGAAAGGTTCTGCAA Chr6:126892356..126892375 59.85 45

*** Putative Vector Insertion (Chr 6: 126892525 - 126894809) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000240270 Chr6:126894810..126894955 ATAAACCGGCTCAGAGCATC Chr6:126894840..126894859 59.3 50
downstream ENSMUSE00000240264 Chr6:126896495..126896676 GCAAAGTCTTCGTCCCAGTC Chr6:126896550..126896569 59.85 55
downstream ENSMUSE00000240255 Chr6:126900076..126900175 CAGCTCCTGCATCACCTTTT Chr6:126900115..126900134 60.4 50
downstream ENSMUSE00000240248 Chr6:126900293..126900414 GGAGCTGTTGTTGGGGTTTT Chr6:126900412..126900431 61.28 50
downstream ENSMUSE00000240241 Chr6:126904753..126904859 AACTGACTCGGCTGCACTTT Chr6:126904785..126904804 60.06 50
downstream ENSMUSE00000240233 Chr6:126905153..126905350 AAAACCAGGCCACAGAGAGA Chr6:126905309..126905328 59.84 50
downstream ENSMUSE00000240227 Chr6:126905867..126905995 AATCCGTGGGAAGTGGAAGT Chr6:126905919..126905938 60.75 50
downstream ENSMUSE00000197683 Chr6:126911984..126912058 CCTCCATTTTGGTTTCCAGA Chr6:126912008..126912027 59.9 45
downstream ENSMUSE00000240212 Chr6:126916898..126917100 TCCCGAGCAGTGATATTTCC Chr6:126917003..126917022 60.04 50
downstream ENSMUSE00000197684 Chr6:126923574..126923631 CTGCTCTCCTTAAACACCAAGG Chr6:126923608..126923629 60.29 50
downstream ENSMUSE00000197680 Chr6:126924505..126924572 AATTCCTCCGTCCCATGAAG Chr6:126924545..126924564 61.21 50
downstream ENSMUSE00000341106 Chr6:126925129..126925722 GTCAGCGTGAGTGTTGAGGA Chr6:126925211..126925230 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGACGGACCTCCTTTTGT Chr6:126892528..126892548 60.49 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGACGGACCTCCTTTTGT Chr6:126892528..126892548 60.49 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030347