Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4534
Trapped Gene
Ptpn3 (ENSMUSG00000038764)
Vector Insertion
Chr 4: 57257936 - 57261529
Public Clones AT0920 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000326345 (Chr4:57261530..57261617 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAAGCCGAATCTTGCTACA Chr4:57261583..57261602 60.35 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000326345 (Chr4:57261530..57261617 -)
Downstram Exon
ENSMUSE00000393711 (Chr4:57257847..57257935 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAAGCCGAATCTTGCTACA Chr4:57261583..57261602 60.35 50 AGACGCAATCCCGATCATTA Chr4:57257875..57257894 60.44 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456676 Chr4:57314544..57314709 ACTCCGGGCTCTGTAGGAAT Chr4:57314687..57314706 60.1 55
upstream ENSMUSE00000673870 Chr4:57313153..57313217 No primer for this exon
upstream ENSMUSE00000340476 Chr4:57282895..57283049 TACCCGAACCTCTGAATTGC Chr4:57282972..57282991 60.07 50
upstream ENSMUSE00000711609 Chr4:57282895..57283049 TACCCGAACCTCTGAATTGC Chr4:57282972..57282991 60.07 50
upstream ENSMUSE00000367916 Chr4:57277855..57277962 CCAGTCGCTTCTGGATATGG Chr4:57277929..57277948 60.62 55
upstream ENSMUSE00000332877 Chr4:57277738..57277780 CCTCAGGAAGCAGCTGAAAG Chr4:57277738..57277757 60.27 55
upstream ENSMUSE00000371437 Chr4:57275301..57275379 TTTTCCCTGTACCCTGCATT Chr4:57275356..57275375 59.43 45
upstream ENSMUSE00000336253 Chr4:57270847..57270891 ATGGATGTTTGCGAAGGAAG Chr4:57270847..57270866 60.07 45
upstream ENSMUSE00000326363 Chr4:57267789..57267841 CTCAACTCAGCGGTGGTTCT Chr4:57267809..57267828 60.44 55
upstream ENSMUSE00000326354 Chr4:57262780..57262900 CTATCTTGCCGACAGCCAGT Chr4:57262841..57262860 60.42 55
upstream ENSMUSE00000326345 Chr4:57261530..57261617 GGAAGCCGAATCTTGCTACA Chr4:57261583..57261602 60.35 50

*** Putative Vector Insertion (Chr 4: 57257936 - 57261529) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000393711 Chr4:57257847..57257935 AGACGCAATCCCGATCATTA Chr4:57257875..57257894 60.44 45
downstream ENSMUSE00000337925 Chr4:57253658..57253721 TGTTTTTGCCGCTGGTGTAT Chr4:57253637..57253656 61.44 45
downstream ENSMUSE00000673864 Chr4:57252400..57252572 GACGCAGGATTTCCACAAGT Chr4:57252473..57252492 60.12 50
downstream ENSMUSE00000673863 Chr4:57248094..57248228 AGCCGTTCCACTGATAAGGA Chr4:57248120..57248139 59.69 50
downstream ENSMUSE00000673862 Chr4:57245194..57245370 CACATCCTCGGTTTCTGTGA Chr4:57245249..57245268 59.68 50
downstream ENSMUSE00000673861 Chr4:57238586..57238772 GGAGCATTCGAAGATGGAGA Chr4:57238670..57238689 60.3 50
downstream ENSMUSE00000673860 Chr4:57238378..57238455 No primer for this exon
downstream ENSMUSE00000673859 Chr4:57236491..57236547 No primer for this exon
downstream ENSMUSE00000673858 Chr4:57234770..57234926 CACCTGGTCATGAGTGTGCT Chr4:57234815..57234834 59.74 55
downstream ENSMUSE00000673857 Chr4:57231381..57231541 CAACACTGTACCGCTTTCCA Chr4:57231371..57231390 59.76 50
downstream ENSMUSE00000461275 Chr4:57219086..57219176 TCCAAATTCTGAGGCAGCTT Chr4:57219093..57219112 59.96 45
downstream ENSMUSE00000506451 Chr4:57218757..57218818 No primer for this exon
downstream ENSMUSE00000527204 Chr4:57217779..57217925 ATCCCAGACAACTTGCCAAA Chr4:57217808..57217827 60.49 45
downstream ENSMUSE00000527203 Chr4:57210378..57210506 AGCATTTCTCGGGACACGTA Chr4:57210372..57210391 60.66 50
downstream ENSMUSE00000673856 Chr4:57209223..57209368 CCCTCAGGGACCTCACATAC Chr4:57209232..57209251 59.38 60
downstream ENSMUSE00000673855 Chr4:57208574..57208709 AACAGGCAGGTTCCTCTCAA Chr4:57208612..57208631 59.84 50
downstream ENSMUSE00000673854 Chr4:57207157..57207234 GAAGGATCGCTTCACACACA Chr4:57207179..57207198 59.84 50
downstream ENSMUSE00000673852 Chr4:57203713..57207234 AGTCACAGACCGGGTGTTTC Chr4:57204060..57204079 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr4:57258460..57258480 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTTCATGGAGGCAGAGTA Chr4:57261525..57261546 59.59 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038764