Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4546
Trapped Gene
Tcf12 (ENSMUSG00000032228)
Vector Insertion
Chr 9: 71791826 - 71848222
Public Clones AJ0492 (sanger) (egtc) IST14532F1 (tigm) IST10879B10 (tigm) IST11001B3 (tigm)
IST14312C10 (tigm) IST11066A9 (tigm) IST14532F1 (tigm) IST14714G3 (tigm)
IST14434E2 (tigm) IST11066E8 (tigm) IST14312C10 (tigm) IST11635G3 (tigm)
IST10860F1 (tigm) IST11360E10 (tigm)
Private Clones OST68111 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217951 (Chr9:71848223..71848325 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGATTAGGAACCCACGAAG Chr9:71848262..71848281 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217951 (Chr9:71848223..71848325 -)
Downstram Exon
ENSMUSE00000217939 (Chr9:71791761..71791825 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGATTAGGAACCCACGAAG Chr9:71848262..71848281 60.07 50 TGCTGTACAGGGAAAATGAGC Chr9:71791765..71791785 60.26 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000496456 Chr9:71959383..71959426 TTAATCGGGAAGGTTGGATG Chr9:71959400..71959419 59.76 45
upstream ENSMUSE00000498545 Chr9:71958545..71958641 TGAAGATGAATCCCCAGCAG Chr9:71958605..71958624 61.15 50
upstream ENSMUSE00000490829 Chr9:71957483..71957555 GGGAAAACGAGACCAACAAC Chr9:71957512..71957531 59.43 50
upstream ENSMUSE00000217941 Chr9:71863445..71863518 ACCAAGCCCCTCCTATGATT Chr9:71863453..71863472 59.79 50
upstream ENSMUSE00000217951 Chr9:71848223..71848325 TCGATTAGGAACCCACGAAG Chr9:71848262..71848281 60.07 50

*** Putative Vector Insertion (Chr 9: 71791826 - 71848222) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217939 Chr9:71791761..71791825 TGCTGTACAGGGAAAATGAGC Chr9:71791765..71791785 60.26 47.62
downstream ENSMUSE00000217949 Chr9:71770459..71770594 TCATGGAGCGGTCTTCTTCT Chr9:71770451..71770470 59.95 50
downstream ENSMUSE00000217934 Chr9:71764812..71764864 CCAGGAGGCACCTTTCTTAC Chr9:71764803..71764822 58.79 55
downstream ENSMUSE00000421924 Chr9:71743737..71743805 TCCAGGGACAGGATAAGCAC Chr9:71743757..71743776 60.07 55
downstream ENSMUSE00000421919 Chr9:71732990..71733095 TCACGGTTGAAATCGTCAGA Chr9:71733033..71733052 60.24 45
downstream ENSMUSE00000217946 Chr9:71731463..71731602 CATCCCATTCGATGAACTCC Chr9:71731534..71731553 60.28 50
downstream ENSMUSE00000217932 Chr9:71730914..71731058 GACATTGGCGGAAGACTTGT Chr9:71730978..71730997 60.12 50
downstream ENSMUSE00000217945 Chr9:71730524..71730588 ATCACCCGTCTGTGAGCTTC Chr9:71730526..71730545 60.27 55
downstream ENSMUSE00000313165 Chr9:71723796..71723874 AGGAGATCCCACTGGTGTTG Chr9:71723787..71723806 59.96 55
downstream ENSMUSE00000313141 Chr9:71717881..71717954 TTGGAGATGAAGGAGCTTGC Chr9:71717885..71717904 60.48 50
downstream ENSMUSE00000217919 Chr9:71716806..71716877 TCTTGCAAATGCTCGTGAAG Chr9:71716815..71716834 60.13 45
downstream ENSMUSE00000217953 Chr9:71715879..71716085 GAAGGTCCAACTGCATGGTT Chr9:71715987..71716006 59.97 50
downstream ENSMUSE00000217937 Chr9:71706647..71706761 AGACAGGACCGAATGATTGC Chr9:71706683..71706702 60.08 50
downstream ENSMUSE00000217948 Chr9:71706291..71706453 TGCCCCTAGATGAGACCTTG Chr9:71706276..71706295 60.21 55
downstream ENSMUSE00000217928 Chr9:71704112..71704344 GCTCTCTGGCATTGTTAGCC Chr9:71704237..71704256 59.99 55
downstream ENSMUSE00000358913 Chr9:71697579..71697732 CAGATGACCCATAGGGTTGG Chr9:71697571..71697590 60.19 55
downstream ENSMUSE00000399521 Chr9:71693560..71694367 GTGCTGACCAGTTGCTTTGA Chr9:71694181..71694200 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGAGTTGCAGTGGTGTCA Chr9:71845207..71845227 59.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGAGTTGCAGTGGTGTCA Chr9:71845207..71845227 59.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGGGGTAGCTGTGTGAGGTA Chr9:71845311..71845332 60.18 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGTAAGCTCCCAACGTGACT Chr9:71845268..71845288 58.37 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032228