Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4551
Trapped Gene
Mtf2 (ENSMUSG00000029267)
Vector Insertion
Chr 5: 108494985 - 108498180
Public Clones AG0200 (sanger) RRD161 (baygenomics) D037E10 (ggtc) P017H02 (ggtc)
P063G07 (ggtc) M016B07 (ggtc) P012B03 (ggtc) P028F09 (ggtc) W253F07 (ggtc)
P025D01 (ggtc) P008B09 (ggtc) G039E06 (ggtc) M013E08 (ggtc) P007F09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692514 (Chr5:108494761..108494984 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGGAACGAGATTGCTTCTA Chr5:108494920..108494939 60.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692514 (Chr5:108494761..108494984 +)
Downstram Exon
ENSMUSE00000692470 (Chr5:108498181..108498542 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGGAACGAGATTGCTTCTA Chr5:108494920..108494939 60.34 50 GGAAGGGGGAGGCATAGTAG Chr5:108498362..108498381 59.92 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692471 Chr5:108494732..108494984 CGGGAACGAGATTGCTTCTA Chr5:108494920..108494939 60.34 50
upstream ENSMUSE00000692514 Chr5:108494761..108494984 CGGGAACGAGATTGCTTCTA Chr5:108494920..108494939 60.34 50
upstream ENSMUSE00000720649 Chr5:108494761..108494984 CGGGAACGAGATTGCTTCTA Chr5:108494920..108494939 60.34 50
upstream ENSMUSE00000692473 Chr5:108494763..108494984 CGGGAACGAGATTGCTTCTA Chr5:108494920..108494939 60.34 50

*** Putative Vector Insertion (Chr 5: 108494985 - 108498180) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000692470 Chr5:108498181..108498542 GGAAGGGGGAGGCATAGTAG Chr5:108498362..108498381 59.92 60
downstream ENSMUSE00000541254 Chr5:108509844..108510042 GACGTAAAGGAGACCGCTTG Chr5:108509899..108509918 59.88 55
downstream ENSMUSE00000692469 Chr5:108509844..108510042 GACGTAAAGGAGACCGCTTG Chr5:108509899..108509918 59.88 55
downstream ENSMUSE00000596085 Chr5:108510156..108510237 GAACCCAGGATTTGGAACTG Chr5:108510219..108510238 59.38 50
downstream ENSMUSE00000692467 Chr5:108510156..108510237 GAACCCAGGATTTGGAACTG Chr5:108510219..108510238 59.38 50
downstream ENSMUSE00000596083 Chr5:108516018..108516113 CCATTTCATTGGGAGCTTCT Chr5:108516092..108516111 59.13 45
downstream ENSMUSE00000692465 Chr5:108516018..108516113 CCATTTCATTGGGAGCTTCT Chr5:108516092..108516111 59.13 45
downstream ENSMUSE00000596082 Chr5:108516315..108516415 CACTGTCGACAAAGCCACTT Chr5:108516396..108516415 58.93 50
downstream ENSMUSE00000596081 Chr5:108516960..108517108 GTCCTTTCTTAAGCGCACCA Chr5:108516987..108517006 60.39 50
downstream ENSMUSE00000596080 Chr5:108521080..108521175 TCTGAAGGCATTGGACACAA Chr5:108521156..108521175 60.24 45
downstream ENSMUSE00000596079 Chr5:108522357..108522425 CTGGTCCAGAACTGCAGACA Chr5:108522400..108522419 60.02 55
downstream ENSMUSE00000596078 Chr5:108523144..108523267 CTCCAGGGTGCAATCTATCC Chr5:108523268..108523287 59.51 55
downstream ENSMUSE00000596077 Chr5:108528138..108528205 TCAGATTTGGGTGTGTCTGC Chr5:108528163..108528182 59.68 50
downstream ENSMUSE00000596076 Chr5:108529832..108530002 GAGGAACACGAATTCGCAAC Chr5:108529899..108529918 60.65 50
downstream ENSMUSE00000596075 Chr5:108533039..108533144 TTGTATATGGGCCAGGAGGA Chr5:108533112..108533131 60.29 50
downstream ENSMUSE00000596074 Chr5:108533285..108533337 TCCAACGTAGGATTCTCTGAAA Chr5:108533320..108533341 58.83 40.91
downstream ENSMUSE00000596073 Chr5:108533445..108533549 TGCTAGCCGAGGTAGTTTCG Chr5:108533536..108533555 60.53 55
downstream ENSMUSE00000491639 Chr5:108535607..108538023 AAGGCGACCTCTTCTTCTCC Chr5:108535694..108535713 59.96 55
downstream ENSMUSE00000692461 Chr5:108535607..108536643 AAGGCGACCTCTTCTTCTCC Chr5:108535694..108535713 59.96 55
downstream ENSMUSE00000692472 Chr5:108535607..108536104 AAGGCGACCTCTTCTTCTCC Chr5:108535694..108535713 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCGACTCTTTGGGAGGAG Chr5:108498006..108498026 60.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTACGTGACTGGGAAAACC Chr5:108498031..108498052 58.42 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029267