Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4578
Trapped Gene
Nfya (ENSMUSG00000023994)
Vector Insertion
Chr 17: 48538394 - 48539762
Public Clones AR0764 (sanger) XT0497 (sanger) RRM151 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000315814 (Chr17:48539763..48539905 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000315814 (Chr17:48539763..48539905 -)
Downstram Exon
ENSMUSE00000315649 (Chr17:48538307..48538393 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TACCTGGAGGGTCTGGACTT Chr17:48538285..48538304 58.59 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000461831 Chr17:48548951..48549090 GTTCAGATTCGCCATTTTGC Chr17:48549060..48549079 60.59 45
upstream ENSMUSE00000315814 Chr17:48539763..48539905 No primer for this exon

*** Putative Vector Insertion (Chr 17: 48538394 - 48539762) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000315649 Chr17:48538307..48538393 TACCTGGAGGGTCTGGACTT Chr17:48538285..48538304 58.59 55
downstream ENSMUSE00000137023 Chr17:48534975..48535121 GGGTTGGCCTGTTGATGTAA Chr17:48535034..48535053 60.76 50
downstream ENSMUSE00000137024 Chr17:48532746..48532877 TGATGATCTGCTGGGTTTGA Chr17:48532765..48532784 60.2 45
downstream ENSMUSE00000137020 Chr17:48532505..48532610 TCCCTGGACAGCAATCTGTT Chr17:48532562..48532581 60.66 50
downstream ENSMUSE00000137022 Chr17:48531665..48531831 GTCCACTGCTGGTTGTGTTG Chr17:48531708..48531727 60.2 55
downstream ENSMUSE00000137019 Chr17:48531201..48531374 CCTTCGTTCCTTTGGGATTT Chr17:48531179..48531198 60.29 45
downstream ENSMUSE00000137021 Chr17:48530574..48530675 GCCGAGACTCATGGAGGTAT Chr17:48530632..48530651 59.12 55
downstream ENSMUSE00000353117 Chr17:48526232..48528667 AAGGCAGCCAACTCTTTTGA Chr17:48527126..48527145 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAGGTATGGGAGCAAGTG Chr17:48539746..48539766 60.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAGGTATGGGAGCAAGTG Chr17:48539746..48539766 60.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023994