Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4622
Trapped Gene
Kctd3 (ENSMUSG00000026608)
Vector Insertion
Chr 1: 190811511 - 190816441
Public Clones AS0681 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000289982 (Chr1:190816442..190816632 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAATGCAAAGGTGGTTGGAG Chr1:190816538..190816557 59.97 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000289982 (Chr1:190816442..190816632 -)
Downstram Exon
ENSMUSE00000160947 (Chr1:190811395..190811510 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAATGCAAAGGTGGTTGGAG Chr1:190816538..190816557 59.97 45 CCAGCTGGTTTCCAATGAAG Chr1:190811432..190811451 60.63 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000534062 Chr1:190831409..190831719 AGATCGTGCAGCTGAATGTG Chr1:190831420..190831439 60.02 50
upstream ENSMUSE00000590863 Chr1:190825784..190825837 ACAGACGCTCATGTGGATTC Chr1:190825803..190825822 58.67 50
upstream ENSMUSE00000590862 Chr1:190825222..190825267 No primer for this exon
upstream ENSMUSE00000534055 Chr1:190824132..190824205 TTCTTCGGACAAAAGAACTCG Chr1:190824139..190824159 59.48 42.86
upstream ENSMUSE00000590861 Chr1:190821156..190821214 AGGCACGAGGCAGAATTTTA Chr1:190821173..190821192 59.85 45
upstream ENSMUSE00000290003 Chr1:190820841..190820921 GGAGCTGGAGAGGTCATCCT Chr1:190820880..190820899 60.76 60
upstream ENSMUSE00000289995 Chr1:190820279..190820419 GCTAGGTCCTCTGTGGATGC Chr1:190820371..190820390 59.83 60
upstream ENSMUSE00000289989 Chr1:190819621..190819711 CGCATTTCGCTGTGTGTTAC Chr1:190819623..190819642 60.32 50
upstream ENSMUSE00000289982 Chr1:190816442..190816632 AAATGCAAAGGTGGTTGGAG Chr1:190816538..190816557 59.97 45

*** Putative Vector Insertion (Chr 1: 190811511 - 190816441) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000160947 Chr1:190811395..190811510 CCAGCTGGTTTCCAATGAAG Chr1:190811432..190811451 60.63 50
downstream ENSMUSE00000160944 Chr1:190807086..190807173 ATTGATCCGTTGTTGCATCC Chr1:190807075..190807094 60.73 45
downstream ENSMUSE00000160952 Chr1:190806889..190807005 TTGGAGGGGTCGTGATAGAG Chr1:190806911..190806930 60.06 55
downstream ENSMUSE00000460598 Chr1:190805104..190805274 CCAGAGCTCGTACCATAGGC Chr1:190805207..190805226 59.86 60
downstream ENSMUSE00000160949 Chr1:190802376..190802531 GACGTGGTTGTTGTCAGCAC Chr1:190802487..190802506 60.21 55
downstream ENSMUSE00000160948 Chr1:190800490..190800586 GATCATCTCGTTCCCCAAAA Chr1:190800541..190800560 59.87 45
downstream ENSMUSE00000160946 Chr1:190798166..190798350 GTGAACAGGTATCGCCTTGG Chr1:190798221..190798240 60.52 55
downstream ENSMUSE00000289932 Chr1:190797945..190798083 CAGATCACACTGGTCCAGCA Chr1:190798006..190798025 60.9 55
downstream ENSMUSE00000497512 Chr1:190794977..190796562 GAACACAGCGGCTCCTAAAG Chr1:190795283..190795302 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGGAGTGTTCAGGATGGA Chr1:190816459..190816479 60.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGGAGTGTTCAGGATGGA Chr1:190816459..190816479 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026608