Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4623
Trapped Gene
Sh3glb1 (ENSMUSG00000037062)
Vector Insertion
Chr 3: 144364811 - 144368476
Public Clones AS0664 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000229034 (Chr3:144368477..144368569 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGATGCTGCAAAAACAAG Chr3:144368514..144368533 59.85 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000229034 (Chr3:144368477..144368569 -)
Downstram Exon
ENSMUSE00000669027 (Chr3:144364772..144364810 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGATGCTGCAAAAACAAG Chr3:144368514..144368533 59.85 40 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000445387 Chr3:144382946..144383110 TGGATTTCAACGTGAAGAAGC Chr3:144382987..144383007 60.24 42.86
upstream ENSMUSE00000229060 Chr3:144375551..144375692 AATGAAGCAGACCGAAGTGC Chr3:144375569..144375588 60.41 50
upstream ENSMUSE00000229053 Chr3:144372197..144372325 AAACAACCCGGAACTTTTGG Chr3:144372248..144372267 61.1 45
upstream ENSMUSE00000229044 Chr3:144369562..144369695 CACAGAAGCGAATTGGAACA Chr3:144369649..144369668 59.84 45
upstream ENSMUSE00000229034 Chr3:144368477..144368569 TTGGATGCTGCAAAAACAAG Chr3:144368514..144368533 59.85 40

*** Putative Vector Insertion (Chr 3: 144364811 - 144368476) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000669027 Chr3:144364772..144364810 No primer for this exon
downstream ENSMUSE00000669026 Chr3:144362818..144362841 GTCACTTCCTCTGCCCAAAT Chr3:144362800..144362819 59.14 50
downstream ENSMUSE00000229027 Chr3:144360342..144360431 GGGTAATCTCTGCCTGACGA Chr3:144360352..144360371 60.22 55
downstream ENSMUSE00000229023 Chr3:144359818..144359918 TCATTCAGACAGCGGAGATG Chr3:144359871..144359890 59.94 50
downstream ENSMUSE00000229018 Chr3:144354864..144355092 GAGGACCCTAGCCTTCCTGT Chr3:144354893..144354912 59.7 60
downstream ENSMUSE00000229010 Chr3:144354032..144354496 TCCATTCCAACGACACTGAA Chr3:144354443..144354462 60.09 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCAAAAGCTGCAGAAACT Chr3:144368484..144368504 59.27 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGAATTCGTGACTGGGAAAA Chr3:144368411..144368433 59.98 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037062