Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4627
Trapped Gene
Rpl22 (ENSMUSG00000028936)
Vector Insertion
Chr 4: 151701695 - 151704112
Public Clones (sanger) (sanger) AS0129 (sanger) RRN153 (baygenomics) (ggtc)
CMHD-GT_340D11-3 (cmhd) CMHD-GT_334H6-3 (cmhd) CMHD-GT_422B6-3 (cmhd) PST26104-NR (escells)
PST20315-NR (escells) PST23662-NR (escells) PST18835-NR (escells) PST21778-NR (escells)
PST23794-NR (escells) PST20196-NR (escells) PST23772-NR (escells) PST17926-NR (escells)
PST21712-NR (escells) PST23687-NR (escells) PST19356-NR (escells) PST23196-NR (escells)
IST11468C11 (tigm)
Private Clones OST462930 (lexicon) OST438916 (lexicon) OST200221 (lexicon) OST174916 (lexicon)
OST174915 (lexicon) OST92585 (lexicon) OST50738 (lexicon) OST37970 (lexicon)
OST26896 (lexicon) OST25051 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000372493 (Chr4:151701590..151701694 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGTTCACCCTGGACTGCAC Chr4:151701635..151701654 60.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000372493 (Chr4:151701590..151701694 +)
Downstram Exon
ENSMUSE00000183663 (Chr4:151704113..151704237 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGTTCACCCTGGACTGCAC Chr4:151701635..151701654 60.16 55 GTTCGATGGTCACGACTCCT Chr4:151704191..151704210 60.12 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661545 Chr4:151699971..151700004 No primer for this exon
upstream ENSMUSE00000372493 Chr4:151701590..151701694 AAGTTCACCCTGGACTGCAC Chr4:151701635..151701654 60.16 55

*** Putative Vector Insertion (Chr 4: 151701695 - 151704112) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000183663 Chr4:151704113..151704237 GTTCGATGGTCACGACTCCT Chr4:151704191..151704210 60.12 55
downstream ENSMUSE00000661544 Chr4:151706389..151706585 CCAGTCTCGGAGGTTGTTCT Chr4:151706446..151706465 59.3 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCATGGATGCTGCCAATTT Chr4:151701675..151701695 60.3 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCATGGATGCTGCCAATTT Chr4:151701675..151701695 60.3 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028936