Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4658
Trapped Gene
EG245174 (ENSMUSG00000079009)
Vector Insertion
Chr 2: 150007607 - 150016221
Public Clones AN0407 (sanger) AM0117 (sanger) (ggtc) (ggtc)
Private Clones OST191400 (lexicon) OST108633 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682134 (Chr2:150007491..150007606 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTGAGCCGGAAAGAAGGT Chr2:150007511..150007530 60.21 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682134 (Chr2:150007491..150007606 +)
Downstram Exon
ENSMUSE00000682137 (Chr2:150016222..150016255 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTGAGCCGGAAAGAAGGT Chr2:150007511..150007530 60.21 50 GCAGCGAGATTCCTGTAGGT Chr2:150016253..150016272 59.46 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682134 Chr2:150007491..150007606 ATCTGAGCCGGAAAGAAGGT Chr2:150007511..150007530 60.21 50

*** Putative Vector Insertion (Chr 2: 150007607 - 150016221) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000682132 Chr2:150016129..150016255 GCAGCGAGATTCCTGTAGGT Chr2:150016253..150016272 59.46 55
downstream ENSMUSE00000682137 Chr2:150016222..150016255 GCAGCGAGATTCCTGTAGGT Chr2:150016253..150016272 59.46 55
downstream ENSMUSE00000682136 Chr2:150016455..150016515 No primer for this exon
downstream ENSMUSE00000682131 Chr2:150017592..150019015 TCCACTTGGAGACGAAAAGG Chr2:150018594..150018613 60.22 50
downstream ENSMUSE00000682135 Chr2:150017592..150018888 TCCACTTGGAGACGAAAAGG Chr2:150018594..150018613 60.22 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTAATCGCCTTGCAGCACA Chr2:150010656..150010676 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTCCCACAAAGGGAGGAG Chr2:150010622..150010642 60.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079009