Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4668
Trapped Gene
Ptges3 (ENSMUSG00000071072)
Vector Insertion
Chr 10: 127509214 - 127511277
Public Clones AL0299 (sanger) (sanger) P135G11 (ggtc) (ggtc)
Private Clones OST197664 (lexicon) OST41851 (lexicon)
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000517322 (Chr10:127509124..127509213 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCTCAGTGTGGACTTCAA Chr10:127509130..127509149 60.44 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000517322 (Chr10:127509124..127509213 +)
Downstram Exon
ENSMUSE00000506418 (Chr10:127511278..127511340 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCTCAGTGTGGACTTCAA Chr10:127509130..127509149 60.44 50 ATCCTCATCACCACCCATGT Chr10:127511310..127511329 60.06 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665445 Chr10:127496038..127496342 CGCCCCTTTTCCTACACTTT Chr10:127496113..127496132 60.47 50
upstream ENSMUSE00000665444 Chr10:127496067..127496342 CGCCCCTTTTCCTACACTTT Chr10:127496113..127496132 60.47 50
upstream ENSMUSE00000573188 Chr10:127505728..127505841 TGCTTCTGCAAAGTGGTACG Chr10:127505734..127505753 60.05 50
upstream ENSMUSE00000461177 Chr10:127506272..127506341 TTGTCTTGGAGGAAGCGATAA Chr10:127506272..127506292 59.83 42.86
upstream ENSMUSE00000493202 Chr10:127507190..127507288 No primer for this exon
upstream ENSMUSE00000517322 Chr10:127509124..127509213 TGGCTCAGTGTGGACTTCAA Chr10:127509130..127509149 60.44 50

*** Putative Vector Insertion (Chr 10: 127509214 - 127511277) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000506418 Chr10:127511278..127511340 ATCCTCATCACCACCCATGT Chr10:127511310..127511329 60.06 50
downstream ENSMUSE00000505855 Chr10:127512394..127512418 No primer for this exon
downstream ENSMUSE00000639522 Chr10:127513123..127514310 AAAATCCAGGCGATGACAAC Chr10:127513170..127513189 59.94 45
downstream ENSMUSE00000665443 Chr10:127513123..127514034 AAAATCCAGGCGATGACAAC Chr10:127513170..127513189 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCGAATTTTGACCGTTTCT Chr10:127509189..127509210 59.6 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCGAATTTTGACCGTTTC Chr10:127509189..127509209 58.6 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071072