Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4672
Trapped Gene
A630089N07Rik (ENSMUSG00000074887)
Vector Insertion
Chr 16: 98289296 - 98303054
Public Clones (sanger) AH0155 (sanger) 3SD166E05 (ggtc) 5SD166E05 (ggtc) IST10814C11BBF1 (tigm)
IST11603C1 (tigm) IST14471G2 (tigm) IST10814C11 (tigm) IST14424G4 (tigm)
IST13769E3 (tigm) IST14171F8 (tigm) IST12773A12 (tigm) IST12750F11 (tigm)
IST15058B2 (tigm) IST15058B2 (tigm) IST14511E11 (tigm) IST11262H11 (tigm)
IST14280B4 (tigm) IST14936A9 (tigm)
Private Clones OST208986 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696803 (Chr16:98303055..98303132 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGCTGTGGATTGTGCTCAG Chr16:98303078..98303097 59.86 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696803 (Chr16:98303055..98303132 -)
Downstram Exon
ENSMUSE00000641758 (Chr16:98289169..98289295 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGCTGTGGATTGTGCTCAG Chr16:98303078..98303097 59.86 50 CAAAGCCCATTCTTCACGAG Chr16:98289217..98289236 60.77 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696803 Chr16:98303055..98303132 ATGCTGTGGATTGTGCTCAG Chr16:98303078..98303097 59.86 50

*** Putative Vector Insertion (Chr 16: 98289296 - 98303054) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641758 Chr16:98289169..98289295 CAAAGCCCATTCTTCACGAG Chr16:98289217..98289236 60.77 50
downstream ENSMUSE00000641757 Chr16:98288920..98288980 No primer for this exon
downstream ENSMUSE00000696802 Chr16:98288305..98288309 No primer for this exon
downstream ENSMUSE00000696800 Chr16:98288184..98288191 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTATGTAATCGCCTTGCAG Chr16:98296989..98297010 59.62 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTATGCGTGACTGGGAAAA Chr16:98290989..98291009 58.62 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CATTGCTTTTGATGTGCAGAA Chr16:98303119..98303140 59.86 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CATTGCTTTTGATGTGCAGAA Chr16:98303119..98303140 59.86 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074887