Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4676
Trapped Gene
Pot1b (ENSMUSG00000024174)
Vector Insertion
Chr 17: 55832176 - 55834324
Public Clones AF0200 (sanger) AE0345 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657186 (Chr17:55834325..55834615 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGCCCATGCAGTATTACG Chr17:55834384..55834403 59.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657186 (Chr17:55834325..55834615 -)
Downstram Exon
ENSMUSE00000657185 (Chr17:55832020..55832175 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGCCCATGCAGTATTACG Chr17:55834384..55834403 59.71 50 TAGGGATTTTGCCACTTGGA Chr17:55832001..55832020 60.44 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694478 Chr17:55839512..55839517 No primer for this exon
upstream ENSMUSE00000139127 Chr17:55839290..55839404 GGAAGGCACTGTTGTCAATG Chr17:55839341..55839360 59.14 50
upstream ENSMUSE00000657187 Chr17:55837755..55837885 CACGATTGTGGACCAGACAA Chr17:55837850..55837869 60.57 50
upstream ENSMUSE00000657186 Chr17:55834325..55834615 TCAGCCCATGCAGTATTACG Chr17:55834384..55834403 59.71 50

*** Putative Vector Insertion (Chr 17: 55832176 - 55834324) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000657185 Chr17:55832020..55832175 TAGGGATTTTGCCACTTGGA Chr17:55832001..55832020 60.44 45
downstream ENSMUSE00000657184 Chr17:55827087..55827256 GACTCTGATCCCACGACCAT Chr17:55827103..55827122 59.93 55
downstream ENSMUSE00000657183 Chr17:55813350..55813438 CTGAGGTCTGAATGGCTTCC Chr17:55813376..55813395 59.8 55
downstream ENSMUSE00000657182 Chr17:55812129..55812191 No primer for this exon
downstream ENSMUSE00000657181 Chr17:55809038..55809194 CTGTCGAGGAGCTCTTTGCT Chr17:55809102..55809121 59.89 55
downstream ENSMUSE00000657180 Chr17:55805710..55805915 AGGACGCCGTCATTCTTTAC Chr17:55805723..55805742 59.2 50
downstream ENSMUSE00000657179 Chr17:55804946..55805081 TTCCCTCGTATGAGGAATGG Chr17:55804939..55804958 59.89 50
downstream ENSMUSE00000657178 Chr17:55803615..55803703 TCTGCCACAGAGGAAGGAAT Chr17:55803595..55803614 59.8 50
downstream ENSMUSE00000657177 Chr17:55801761..55801852 TCCAATACTCCGGTTCCATC Chr17:55801758..55801777 59.75 50
downstream ENSMUSE00000657176 Chr17:55794065..55794170 GATGCTGGGATCTGGAAAAA Chr17:55794123..55794142 60.01 45
downstream ENSMUSE00000657175 Chr17:55791323..55792816 AGGCTCCTCTCCATTTCCAT Chr17:55791785..55791804 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000024174