Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4690
Trapped Gene
Ccdc55 (ENSMUSG00000037958)
Vector Insertion
Chr 11: 76864215 - 76868445
Public Clones AD0013 (sanger)
Private Clones OST443458 (lexicon) OST64370 (lexicon) OST569 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000293705 (Chr11:76868446..76868502 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAGCGAAAGCCTTCAGAG Chr11:76868477..76868496 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000293705 (Chr11:76868446..76868502 -)
Downstram Exon
ENSMUSE00000293697 (Chr11:76864086..76864214 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAGCGAAAGCCTTCAGAG Chr11:76868477..76868496 60.28 55 GCTTGGGGTTGTTTTCTTCC Chr11:76864087..76864106 60.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661751 Chr11:76891881..76891937 AGCGGAGACGGGAACAAGAT Chr11:76891899..76891918 63.34 55
upstream ENSMUSE00000661750 Chr11:76890156..76890246 CGTTGCACCGAGTTTTACAG Chr11:76890195..76890214 59.39 50
upstream ENSMUSE00000293705 Chr11:76868446..76868502 GTGAGCGAAAGCCTTCAGAG Chr11:76868477..76868496 60.28 55

*** Putative Vector Insertion (Chr 11: 76864215 - 76868445) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000293697 Chr11:76864086..76864214 GCTTGGGGTTGTTTTCTTCC Chr11:76864087..76864106 60.84 50
downstream ENSMUSE00000293687 Chr11:76862775..76862982 TCCGTTTTCCATCTCTCGTT Chr11:76862856..76862875 59.67 45
downstream ENSMUSE00000293678 Chr11:76861855..76861963 TCTGCTTGGTCACATCCAAA Chr11:76861918..76861937 60.24 45
downstream ENSMUSE00000661749 Chr11:76857794..76860256 GGCCTCTCTGTGCCTATGAG Chr11:76859823..76859842 59.97 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCATGAAACAGGTACGAG Chr11:76865437..76865457 60.52 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGCGTGACTGGGAAAACC Chr11:76865378..76865398 59.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037958