Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4705
Trapped Gene
Ubap2 (ENSMUSG00000028433)
Vector Insertion
Chr 4: 41198705 - 41222072
Public Clones AA0048 (sanger) Ex256 (baygenomics) P055H12 (ggtc) P105A11 (ggtc)
P109B11 (ggtc) P143E11 (ggtc) P113H02 (ggtc) FHCRC-GT-S3-6G1 (fhcrc) PST2606-NL (escells)
PST12605-NL (escells) PST1093 (escells) PST1073-1 (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000513201 (Chr4:41222073..41222168 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGCTTTGTAAGAGGCACAT Chr4:41222129..41222148 60.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000513201 (Chr4:41222073..41222168 -)
Downstram Exon
ENSMUSE00000714065 (Chr4:41198568..41198704 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGCTTTGTAAGAGGCACAT Chr4:41222129..41222148 60.27 50 CTGCACCACTTGTTTCTGTGA Chr4:41198546..41198566 59.93 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000513201 Chr4:41222073..41222168 CCGCTTTGTAAGAGGCACAT Chr4:41222129..41222148 60.27 50
upstream ENSMUSE00000675458 Chr4:41222073..41222177 CCGCTTTGTAAGAGGCACAT Chr4:41222129..41222148 60.27 50

*** Putative Vector Insertion (Chr 4: 41198705 - 41222072) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000711075 Chr4:41198568..41198704 CTGCACCACTTGTTTCTGTGA Chr4:41198546..41198566 59.93 47.62
downstream ENSMUSE00000714065 Chr4:41198568..41198704 CTGCACCACTTGTTTCTGTGA Chr4:41198546..41198566 59.93 47.62
downstream ENSMUSE00000718657 Chr4:41198568..41198704 CTGCACCACTTGTTTCTGTGA Chr4:41198546..41198566 59.93 47.62
downstream ENSMUSE00000675430 Chr4:41192489..41192525 CAGGCTGAGCTCAAGAAGTG Chr4:41192467..41192486 58.91 55
downstream ENSMUSE00000179088 Chr4:41182550..41182627 No primer for this exon
downstream ENSMUSE00000179110 Chr4:41180637..41180747 CGATGCATTCATCCTGATTTT Chr4:41180686..41180706 59.92 38.1
downstream ENSMUSE00000179130 Chr4:41176728..41176881 GTCCACGACTCGCTTCTCTC Chr4:41176754..41176773 60.14 60
downstream ENSMUSE00000295141 Chr4:41174232..41174309 GCTGCAGTCAATCCCATTCT Chr4:41174256..41174275 60.23 50
downstream ENSMUSE00000295135 Chr4:41173313..41173367 No primer for this exon
downstream ENSMUSE00000295127 Chr4:41170389..41170492 AACTTTGTCCCACAGCCATC Chr4:41170411..41170430 59.97 50
downstream ENSMUSE00000714408 Chr4:41168589..41168654 TTTACTTGGCGGTTCCTGAG Chr4:41168586..41168605 60.24 50
downstream ENSMUSE00000718362 Chr4:41168589..41168654 TTTACTTGGCGGTTCCTGAG Chr4:41168586..41168605 60.24 50
downstream ENSMUSE00000295116 Chr4:41165344..41165396 No primer for this exon
downstream ENSMUSE00000675428 Chr4:41165344..41165396 No primer for this exon
downstream ENSMUSE00000179137 Chr4:41163599..41163666 TGACATGGTTCTCTGCTGGA Chr4:41163590..41163609 60.4 50
downstream ENSMUSE00000675427 Chr4:41163599..41163666 TGACATGGTTCTCTGCTGGA Chr4:41163590..41163609 60.4 50
downstream ENSMUSE00000675455 Chr4:41160783..41160847 GCCCAGGAAACTCAGTGGTA Chr4:41160787..41160806 60.11 55
downstream ENSMUSE00000179122 Chr4:41158738..41158927 TGGTGCCATCTGATTGTTGT Chr4:41158764..41158783 59.97 45
downstream ENSMUSE00000675426 Chr4:41158738..41158927 TGGTGCCATCTGATTGTTGT Chr4:41158764..41158783 59.97 45
downstream ENSMUSE00000179086 Chr4:41156386..41156602 TCTCCAAATCCTGAGCCAAG Chr4:41156552..41156571 60.33 50
downstream ENSMUSE00000675425 Chr4:41156386..41156602 TCTCCAAATCCTGAGCCAAG Chr4:41156552..41156571 60.33 50
downstream ENSMUSE00000675424 Chr4:41153866..41154137 GGAAGCTGCAAAAGTCTGCT Chr4:41153935..41153954 59.76 50
downstream ENSMUSE00000711477 Chr4:41153866..41154137 GGAAGCTGCAAAAGTCTGCT Chr4:41153935..41153954 59.76 50
downstream ENSMUSE00000717168 Chr4:41153866..41154137 GGAAGCTGCAAAAGTCTGCT Chr4:41153935..41153954 59.76 50
downstream ENSMUSE00000179096 Chr4:41153186..41153358 GGCTCTGATCCAAATTCCAG Chr4:41153248..41153267 59.63 50
downstream ENSMUSE00000675452 Chr4:41153186..41153358 GGCTCTGATCCAAATTCCAG Chr4:41153248..41153267 59.63 50
downstream ENSMUSE00000179115 Chr4:41152557..41152770 AGCACTGGTCATTGGGAAAG Chr4:41152712..41152731 60.11 50
downstream ENSMUSE00000675451 Chr4:41152557..41152770 AGCACTGGTCATTGGGAAAG Chr4:41152712..41152731 60.11 50
downstream ENSMUSE00000179148 Chr4:41150566..41150605 No primer for this exon
downstream ENSMUSE00000675450 Chr4:41150566..41150605 No primer for this exon
downstream ENSMUSE00000179118 Chr4:41149307..41149490 GCGGAAGGGTCTGTCTTCTT Chr4:41149426..41149445 60.77 55
downstream ENSMUSE00000675448 Chr4:41149307..41149490 GCGGAAGGGTCTGTCTTCTT Chr4:41149426..41149445 60.77 55
downstream ENSMUSE00000179129 Chr4:41148497..41148566 GCAGAGGTCATGCTGTTCTG Chr4:41148509..41148528 59.58 55
downstream ENSMUSE00000675447 Chr4:41148497..41148566 GCAGAGGTCATGCTGTTCTG Chr4:41148509..41148528 59.58 55
downstream ENSMUSE00000179123 Chr4:41146749..41146935 CTGCTAGGGACGCTCACAGT Chr4:41146759..41146778 60.61 60
downstream ENSMUSE00000675445 Chr4:41146749..41146935 CTGCTAGGGACGCTCACAGT Chr4:41146759..41146778 60.61 60
downstream ENSMUSE00000179094 Chr4:41146527..41146618 GCCCACGAGGTACTGATTGT Chr4:41146532..41146551 60 55
downstream ENSMUSE00000675443 Chr4:41146527..41146618 GCCCACGAGGTACTGATTGT Chr4:41146532..41146551 60 55
downstream ENSMUSE00000179128 Chr4:41146251..41146298 CTGCAGCATCTGGAGCTCAT Chr4:41146244..41146263 61.68 55
downstream ENSMUSE00000675441 Chr4:41146251..41146298 CTGCAGCATCTGGAGCTCAT Chr4:41146244..41146263 61.68 55
downstream ENSMUSE00000179117 Chr4:41143763..41143841 TGCAAAGGGAATTCCATAGTAA Chr4:41143796..41143817 58.63 36.36
downstream ENSMUSE00000675440 Chr4:41143763..41143841 TGCAAAGGGAATTCCATAGTAA Chr4:41143796..41143817 58.63 36.36
downstream ENSMUSE00000179127 Chr4:41143361..41143566 AGTAGGGGAGGCCGGTATAG Chr4:41143383..41143402 59.46 60
downstream ENSMUSE00000675439 Chr4:41143361..41143566 AGTAGGGGAGGCCGGTATAG Chr4:41143383..41143402 59.46 60
downstream ENSMUSE00000179114 Chr4:41142977..41143076 No primer for this exon
downstream ENSMUSE00000675437 Chr4:41142977..41143076 No primer for this exon
downstream ENSMUSE00000179120 Chr4:41142779..41142886 GCCACCCTTGGTGTAGTCTC Chr4:41142812..41142831 59.58 60
downstream ENSMUSE00000675435 Chr4:41142779..41142886 GCCACCCTTGGTGTAGTCTC Chr4:41142812..41142831 59.58 60
downstream ENSMUSE00000179135 Chr4:41142641..41142705 AGGTAAGCCAGTGCCTGAAG Chr4:41142652..41142671 59.5 55
downstream ENSMUSE00000675434 Chr4:41142641..41142705 AGGTAAGCCAGTGCCTGAAG Chr4:41142652..41142671 59.5 55
downstream ENSMUSE00000179082 Chr4:41142367..41142558 TGAAATCCCTGCTTGTCAAA Chr4:41142514..41142533 59.25 40
downstream ENSMUSE00000675433 Chr4:41142367..41142558 TGAAATCCCTGCTTGTCAAA Chr4:41142514..41142533 59.25 40
downstream ENSMUSE00000380981 Chr4:41141349..41142279 TGCTGGACAGGGGTTATTTC Chr4:41141634..41141653 59.93 50
downstream ENSMUSE00000675432 Chr4:41141349..41142279 TGCTGGACAGGGGTTATTTC Chr4:41141634..41141653 59.93 50
downstream ENSMUSE00000675457 Chr4:41141346..41142279 TGCTGGACAGGGGTTATTTC Chr4:41141634..41141653 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGCTAGCAGGGCACACTTT Chr4:41201094..41201114 60.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAACGTGACTGGGAAAACC Chr4:41213005..41213025 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTGGTTAATCGCCTTGCAG Chr4:41213104..41213124 60.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGTACGTGACTGGGAAAACC Chr4:41213102..41213122 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028433