Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4710
Trapped Gene
G3bp1 (ENSMUSG00000018583)
Vector Insertion
Chr 11: 55283304 - 55299127
Public Clones (sanger) XT0126 (sanger) BGB116 (baygenomics) XST022 (baygenomics) YTB043 (baygenomics)
RST155 (baygenomics) XST004 (baygenomics) RST517 (baygenomics) BGA215 (baygenomics)
XST019 (baygenomics) XG696 (baygenomics) P017G07 (ggtc) P140E09 (ggtc)
(ggtc) E028B04 (ggtc) A001A09 (ggtc) 5SP141C01 (ggtc) P140E09 (ggtc)
(ggtc) P017H07 (ggtc) D138C05 (ggtc) E028C04 (ggtc) (ggtc)
PST8248-NL (escells) PST19069-NR (escells) IST14647C11 (tigm)
Private Clones OST232595 (lexicon) OST152927 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000653304 (Chr11:55283187..55283303 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000653304 (Chr11:55283187..55283303 +)
Downstram Exon
ENSMUSE00000307184 (Chr11:55299128..55299240 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000653304 Chr11:55283187..55283303 No primer for this exon

*** Putative Vector Insertion (Chr 11: 55283304 - 55299127) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307184 Chr11:55299128..55299240 No primer for this exon
downstream ENSMUSE00000488085 Chr11:55300981..55301062 No primer for this exon
downstream ENSMUSE00000102563 Chr11:55302521..55302694 No primer for this exon
downstream ENSMUSE00000102566 Chr11:55305466..55305556 No primer for this exon
downstream ENSMUSE00000102545 Chr11:55306950..55307043 No primer for this exon
downstream ENSMUSE00000307157 Chr11:55308755..55308953 No primer for this exon
downstream ENSMUSE00000102555 Chr11:55309646..55309747 No primer for this exon
downstream ENSMUSE00000102548 Chr11:55311153..55311264 No primer for this exon
downstream ENSMUSE00000102559 Chr11:55311415..55311543 No primer for this exon
downstream ENSMUSE00000512180 Chr11:55312060..55312169 No primer for this exon
downstream ENSMUSE00000414482 Chr11:55312961..55314013 No primer for this exon
downstream ENSMUSE00000653300 Chr11:55312961..55314013 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTAATCGCCTTGCAGCACA Chr11:55283353..55283373 63.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTTTTGGTGACGTGACTGG Chr11:55283343..55283364 59.88 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018583