Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4711
Trapped Gene
8430426H19Rik (ENSMUSG00000055228)
Vector Insertion
Chr 13: 62558420 - 62568066
Public Clones XT0124 (sanger) IST13471H8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681633 (Chr13:62568067..62568149 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATTGCCAGCGATCTACGAC Chr13:62568078..62568097 60.24 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681633 (Chr13:62568067..62568149 -)
Downstram Exon
ENSMUSE00000576353 (Chr13:62558293..62558419 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATTGCCAGCGATCTACGAC Chr13:62568078..62568097 60.24 50 GTTCACATGCACGTCCTCAT Chr13:62558365..62558384 59.56 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681633 Chr13:62568067..62568149 AATTGCCAGCGATCTACGAC Chr13:62568078..62568097 60.24 50

*** Putative Vector Insertion (Chr 13: 62558420 - 62568066) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000576353 Chr13:62558293..62558419 GTTCACATGCACGTCCTCAT Chr13:62558365..62558384 59.56 50
downstream ENSMUSE00000576351 Chr13:62558047..62558107 ATGGGCTTCCCAATTAAAGC Chr13:62558066..62558085 60.28 45
downstream ENSMUSE00000484388 Chr13:62556336..62556553 GAATCCTTTCATGCCTTTGG Chr13:62556428..62556447 59.51 45
downstream ENSMUSE00000576349 Chr13:62555683..62556333 ATGACCGTATTGGGAAAAGG Chr13:62555694..62555713 58.76 45
downstream ENSMUSE00000521021 Chr13:62554834..62556553 GGATTCTGGCCCCTACAAAT Chr13:62554939..62554958 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTGGGAAAGATGTTAATCC Chr13:62568070..62568091 59.65 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTGGAAACTCGTGACTGG Chr13:62568006..62568026 60.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCCTTATAATCGCCTTGCAG Chr13:62562085..62562105 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATGTCGTGACTGGGAAAACC Chr13:62568083..62568103 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055228