Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4716
Trapped Gene
BX890623.7-201 (ENSMUSG00000078891)
Vector Insertion
Chr 2: 175597290 - 175605171
Public Clones XS0101 (sanger) XK272 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678829 (Chr2:175605172..175605267 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCGTGACTCTACTGGGTGT Chr2:175605211..175605230 59.34 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678829 (Chr2:175605172..175605267 -)
Downstram Exon
ENSMUSE00000678828 (Chr2:175597163..175597289 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCGTGACTCTACTGGGTGT Chr2:175605211..175605230 59.34 55 TCTGAGAAGCATCCAGCAAA Chr2:175597195..175597214 59.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678825 Chr2:175605172..175605309 TGCGTGACTCTACTGGGTGT Chr2:175605211..175605230 59.34 55
upstream ENSMUSE00000678829 Chr2:175605172..175605267 TGCGTGACTCTACTGGGTGT Chr2:175605211..175605230 59.34 55

*** Putative Vector Insertion (Chr 2: 175597290 - 175605171) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678828 Chr2:175597163..175597289 TCTGAGAAGCATCCAGCAAA Chr2:175597195..175597214 59.67 45
downstream ENSMUSE00000678824 Chr2:175596891..175596951 No primer for this exon
downstream ENSMUSE00000678827 Chr2:175596891..175596951 No primer for this exon
downstream ENSMUSE00000678823 Chr2:175594298..175594593 TCAATGCTTGCTGCAAAGAC Chr2:175594473..175594492 60.14 45
downstream ENSMUSE00000678826 Chr2:175593640..175593679 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCAAGGATCAGGAATCT Chr2:175599183..175599203 59.39 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCAAGGATCAGGAATCT Chr2:175599183..175599203 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078891