Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4738
Trapped Gene
Cep68 (ENSMUSG00000044066)
Vector Insertion
Chr 11: 20149309 - 20149375
Public Clones AS0590 (sanger) XP0205 (sanger) NPX206 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680880 (Chr11:20149310..20149374 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680880 (Chr11:20149310..20149374 -)
Downstram Exon
ENSMUSE00000337123 (Chr11:20149310..20149421 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337123 Chr11:20149310..20149421 No primer for this exon
upstream ENSMUSE00000680880 Chr11:20149310..20149374 No primer for this exon

*** Putative Vector Insertion (Chr 11: 20149309 - 20149375) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000389471 Chr11:20141889..20142241 TGTAGGGGCTGATCTGGTTC Chr11:20142057..20142076 60.07 55
downstream ENSMUSE00000712621 Chr11:20141889..20142241 TGTAGGGGCTGATCTGGTTC Chr11:20142057..20142076 60.07 55
downstream ENSMUSE00000333483 Chr11:20139199..20140701 CAGTCAACTCGGGAGAGGAG Chr11:20140349..20140368 59.98 60
downstream ENSMUSE00000370638 Chr11:20138469..20138591 GACCTGTAAGGCTGGTCCTG Chr11:20138473..20138492 59.72 60
downstream ENSMUSE00000680871 Chr11:20138389..20138591 CATCCCCGTGGATAAACAAG Chr11:20138410..20138429 60.18 50
downstream ENSMUSE00000440688 Chr11:20136009..20136105 CTGGGGTGTTATCCAACAGG Chr11:20135987..20136006 60.22 55
downstream ENSMUSE00000706151 Chr11:20130431..20130597 AAGATGATCTGCACGGCTCT Chr11:20130508..20130527 59.98 50
downstream ENSMUSE00000440702 Chr11:20130427..20130597 AAGATGATCTGCACGGCTCT Chr11:20130508..20130527 59.98 50
downstream ENSMUSE00000655325 Chr11:20128509..20129484 AAAGACTCCCCGCTTTTCAT Chr11:20128787..20128806 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGTGCTAATCGCCTTGCAG Chr11:20149310..20149330 63.66 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000044066