Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4745
Trapped Gene
4921513D23Rik (ENSMUSG00000060657)
Vector Insertion
Chr 16: 14154125 - 14159236
Public Clones CB0301 (sanger) D183G07 (ggtc) D183G07 (ggtc) IST14997A5 (tigm)
Private Clones OST295423 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000704215 (Chr16:14159237..14159367 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGAGTCGGGAATCAAAATA Chr16:14159307..14159326 59.89 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000704215 (Chr16:14159237..14159367 -)
Downstram Exon
ENSMUSE00000423422 (Chr16:14153925..14154124 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGAGTCGGGAATCAAAATA Chr16:14159307..14159326 59.89 45 TGCAAGGGTTCTCAGTTCCT Chr16:14154013..14154032 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704215 Chr16:14159237..14159367 CGGAGTCGGGAATCAAAATA Chr16:14159307..14159326 59.89 45

*** Putative Vector Insertion (Chr 16: 14154125 - 14159236) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000423422 Chr16:14153925..14154124 TGCAAGGGTTCTCAGTTCCT Chr16:14154013..14154032 59.84 50
downstream ENSMUSE00000563171 Chr16:14152119..14152805 TGCTTGCAGGAAGGTAGGTT Chr16:14152359..14152378 59.88 50
downstream ENSMUSE00000482195 Chr16:14152051..14152796 TGCTTGCAGGAAGGTAGGTT Chr16:14152359..14152378 59.88 50
downstream ENSMUSE00000423387 Chr16:14151235..14151409 GGCCAGATTTTAGCAGCATC Chr16:14151347..14151366 59.81 50
downstream ENSMUSE00000704210 Chr16:14151235..14151365 CCTTTTGTTCCACAGCCATT Chr16:14151275..14151294 59.97 45
downstream ENSMUSE00000704209 Chr16:14149114..14149335 AGGGGACTGAGCAGTTTTCA Chr16:14149224..14149243 59.84 50
downstream ENSMUSE00000423380 Chr16:14149109..14149335 AGGGGACTGAGCAGTTTTCA Chr16:14149224..14149243 59.84 50
downstream ENSMUSE00000423373 Chr16:14146817..14146934 TCATCAGCAGCATTCTTTGC Chr16:14146866..14146885 60.1 45
downstream ENSMUSE00000423363 Chr16:14146010..14146182 CACTGAGTTCCAACGCAAAA Chr16:14146131..14146150 59.88 45
downstream ENSMUSE00000704208 Chr16:14146010..14146185 CACTGAGTTCCAACGCAAAA Chr16:14146131..14146150 59.88 45
downstream ENSMUSE00000423358 Chr16:14142325..14142750 CCTGGTTTATGAAGCGGAGA Chr16:14142581..14142600 60.21 50
downstream ENSMUSE00000261926 Chr16:14141981..14142138 CACTGAAGCAGTTGGACCAC Chr16:14142012..14142031 59.31 55
downstream ENSMUSE00000563163 Chr16:14141736..14141894 GAATGCGGATGGGTAGCTTA Chr16:14141776..14141795 60.06 50
downstream ENSMUSE00000621696 Chr16:14140276..14140438 TTGGCAATGTTGAAAGCAAG Chr16:14140387..14140406 59.85 40
downstream ENSMUSE00000704214 Chr16:14140276..14140465 GGGATTGGCAATGTTGAAAG Chr16:14140383..14140402 60.31 45
downstream ENSMUSE00000621695 Chr16:14138436..14138614 TCGTGCAGGTTTCTCATCTG Chr16:14138519..14138538 59.98 50
downstream ENSMUSE00000621694 Chr16:14137031..14137111 AAAGAGAGGCAAGCAACAGG Chr16:14137035..14137054 59.62 50
downstream ENSMUSE00000621693 Chr16:14132663..14132899 GTTTCCCTGTTCACGGATTG Chr16:14132805..14132824 60.35 50
downstream ENSMUSE00000621692 Chr16:14132453..14132572 TGAACTTGAGGTGCGAACAC Chr16:14132473..14132492 59.88 50
downstream ENSMUSE00000621691 Chr16:14131540..14131715 TCTAAGGGGACACCCTTGTG Chr16:14131619..14131638 59.96 55
downstream ENSMUSE00000621690 Chr16:14129739..14129959 AAGGGATGAAATTGCTGACG Chr16:14129812..14129831 60.07 45
downstream ENSMUSE00000621689 Chr16:14128844..14128986 CTCTCACGATGACCTGCTTG Chr16:14128844..14128863 59.57 55
downstream ENSMUSE00000621688 Chr16:14128604..14128737 GTCGTCATCTTGTTGGGACA Chr16:14128607..14128626 59.53 50
downstream ENSMUSE00000621687 Chr16:14127149..14127351 TGGCTTCCAAAAGTTCAAGC Chr16:14127144..14127163 60.37 45
downstream ENSMUSE00000470353 Chr16:14126035..14126262 CTTAACAAACTGGGCGGCTA Chr16:14126160..14126179 60.26 50
downstream ENSMUSE00000261841 Chr16:14120317..14120547 GACCAGCAACTGAGCAGTGA Chr16:14120445..14120464 60.19 55
downstream ENSMUSE00000261837 Chr16:14117376..14117588 GGGATGGCTCCCAGTAATTC Chr16:14117358..14117377 60.66 55
downstream ENSMUSE00000261830 Chr16:14116083..14116143 No primer for this exon
downstream ENSMUSE00000704211 Chr16:14115818..14115934 CTGTTCGGAGCTGGAGTTCT Chr16:14115796..14115815 59.6 55
downstream ENSMUSE00000261824 Chr16:14115812..14115934 AGTACCTGTTCGGAGCTGGA Chr16:14115791..14115810 59.87 55
downstream ENSMUSE00000261820 Chr16:14114276..14114446 TGGTCTTAGCTGAGGGGATG Chr16:14114318..14114337 60.21 55
downstream ENSMUSE00000621686 Chr16:14110626..14111864 TCAGACAGTTTTCCCCCATC Chr16:14111553..14111572 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGCTAGTGGCTGAGGTGA Chr16:14156231..14156251 60.56 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGCTAGTGGCTGAGGTGA Chr16:14156231..14156251 60.56 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGAGAAGCGTATCGGTTTTGC Chr16:14156389..14156410 60.76 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGAGAAGCGTATCGGTTTTGC Chr16:14156389..14156410 60.76 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060657