Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4747
Trapped Gene
AC145736.4-202 (ENSMUSG00000054574)
Vector Insertion
Chr 9: 104118098 - 104120041
Public Clones AX0472 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000348139 (Chr9:104120042..104120098 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAGCTGGATTGGTTATGA Chr9:104120056..104120075 59.89 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000348139 (Chr9:104120042..104120098 -)
Downstram Exon
ENSMUSE00000385934 (Chr9:104117976..104118097 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAGCTGGATTGGTTATGA Chr9:104120056..104120075 59.89 50 GTAAGCATGCGCTGATCTGA Chr9:104117960..104117979 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634687 Chr9:104165029..104165264 CGCCTCCATCCTACTCAAGA Chr9:104165085..104165104 60.35 55
upstream ENSMUSE00000390659 Chr9:104149090..104149170 ACACAACCAAGCACTCATGG Chr9:104149098..104149117 59.6 50
upstream ENSMUSE00000395222 Chr9:104140795..104140870 TTTTCAGTTGGAACCCATGC Chr9:104140838..104140857 60.87 45
upstream ENSMUSE00000359798 Chr9:104139907..104140056 TTCGTAAAGGCAGTGGGAAG Chr9:104139967..104139986 60.24 50
upstream ENSMUSE00000342289 Chr9:104139466..104139507 GCAGAGGGAAAAATCACAGG Chr9:104139470..104139489 59.67 50
upstream ENSMUSE00000396990 Chr9:104135864..104136064 CTGGAGCGATGCAAAGAAAC Chr9:104136022..104136041 60.91 50
upstream ENSMUSE00000382345 Chr9:104133161..104133367 AGAACACGCTGGCAACTACA Chr9:104133301..104133320 59.51 50
upstream ENSMUSE00000337353 Chr9:104132971..104133066 GAAAAGAGTTCTGGCGGTCA Chr9:104133039..104133058 60.38 50
upstream ENSMUSE00000364491 Chr9:104132340..104132431 TAAAAGGGCAAGTTCGGAAA Chr9:104132357..104132376 59.69 40
upstream ENSMUSE00000338430 Chr9:104131205..104131371 GAGGAAGTCGAGAGCCTTCA Chr9:104131231..104131250 59.68 55
upstream ENSMUSE00000356888 Chr9:104131011..104131090 CCTACAGTGGAGTGCTGCAT Chr9:104131026..104131045 58.91 55
upstream ENSMUSE00000404720 Chr9:104130753..104130922 GGGGATGTTGTAGCCTCAAA Chr9:104130837..104130856 59.93 50
upstream ENSMUSE00000379751 Chr9:104123734..104123833 AAGCAACAACGGAGTCATCC Chr9:104123769..104123788 60.12 50
upstream ENSMUSE00000408274 Chr9:104122201..104122308 No primer for this exon
upstream ENSMUSE00000383100 Chr9:104120857..104121012 CTGAAGGGCAGCAGTTTGAT Chr9:104120911..104120930 60.4 50
upstream ENSMUSE00000348139 Chr9:104120042..104120098 GGGAGCTGGATTGGTTATGA Chr9:104120056..104120075 59.89 50

*** Putative Vector Insertion (Chr 9: 104118098 - 104120041) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000385934 Chr9:104117976..104118097 GTAAGCATGCGCTGATCTGA Chr9:104117960..104117979 60.13 50
downstream ENSMUSE00000412641 Chr9:104116453..104116528 TGTGTTATCAGCGGTCCAGA Chr9:104116461..104116480 60.26 50
downstream ENSMUSE00000367061 Chr9:104116147..104116242 CTTCTCCGGAACTGGATCTG Chr9:104116170..104116189 59.8 55
downstream ENSMUSE00000342773 Chr9:104115091..104115234 TCCTATCCCTCCAGTGCATC Chr9:104115089..104115108 60.03 55
downstream ENSMUSE00000692361 Chr9:104111635..104111717 TCGAAGAACTACTGGCTTTTGA Chr9:104111666..104111687 59.15 40.91
downstream ENSMUSE00000692360 Chr9:104110083..104110236 TCGATCTAGCGTGGTCTTGA Chr9:104110189..104110208 59.55 50
downstream ENSMUSE00000692359 Chr9:104105745..104105848 TCTGCCAGGCACTCATATTT Chr9:104105804..104105823 58.33 45
downstream ENSMUSE00000692358 Chr9:104105502..104105661 GAGCAGGAAGCGATGGTAGA Chr9:104105600..104105619 60.5 55
downstream ENSMUSE00000692356 Chr9:104104218..104104280 TCCCGCTCGAGTTTATCAGT Chr9:104104236..104104255 59.84 50
downstream ENSMUSE00000692354 Chr9:104102767..104102867 TCTAATGCCGTTTGAGTCCA Chr9:104102808..104102827 59.27 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTGTGAAGGGAGCTGGAT Chr9:104120063..104120083 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTGTGAAGGGAGCTGGAT Chr9:104120063..104120083 59.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054574