Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4752
Trapped Gene
Etv5 (ENSMUSG00000013089)
Vector Insertion
Chr 16: 22436141 - 22436273
Public Clones AX0254 (sanger) D073C08 (ggtc) D063D05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000378517 (Chr16:22436274..22436361 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000378517 (Chr16:22436274..22436361 -)
Downstram Exon
ENSMUSE00000310554 (Chr16:22436093..22436140 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000560923 Chr16:22439590..22439691 No primer for this exon
upstream ENSMUSE00000407999 Chr16:22436511..22436633 No primer for this exon
upstream ENSMUSE00000378517 Chr16:22436274..22436361 No primer for this exon

*** Putative Vector Insertion (Chr 16: 22436141 - 22436273) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000310554 Chr16:22436093..22436140 No primer for this exon
downstream ENSMUSE00000478899 Chr16:22435950..22436000 No primer for this exon
downstream ENSMUSE00000644755 Chr16:22421892..22421945 No primer for this exon
downstream ENSMUSE00000414095 Chr16:22412918..22413047 No primer for this exon
downstream ENSMUSE00000497015 Chr16:22411706..22411993 No primer for this exon
downstream ENSMUSE00000362934 Chr16:22401745..22402004 No primer for this exon
downstream ENSMUSE00000310460 Chr16:22399393..22399452 No primer for this exon
downstream ENSMUSE00000310522 Chr16:22393060..22393128 No primer for this exon
downstream ENSMUSE00000131370 Chr16:22392728..22392897 No primer for this exon
downstream ENSMUSE00000560895 Chr16:22386830..22386931 No primer for this exon
downstream ENSMUSE00000702629 Chr16:22381385..22383764 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAGTGCAGCTGTCCCTGTG Chr16:22436252..22436272 59.49 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACACCGTGACTGGGAAAAC Chr16:22436207..22436227 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013089