Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4768
Trapped Gene
Shroom3 (ENSMUSG00000029381)
Vector Insertion
Chr 5: 93384438 - 93391116
Public Clones AW0632 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000321182 (Chr5:93384287..93384437 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCACAAGGAGGCAGTGAGT Chr5:93384292..93384311 59.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000321182 (Chr5:93384287..93384437 +)
Downstram Exon
ENSMUSE00000321177 (Chr5:93391117..93391389 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCACAAGGAGGCAGTGAGT Chr5:93384292..93384311 59.76 55 TTCAGCTTGATGTCCGTGAG Chr5:93391202..93391221 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000475607 Chr5:93112461..93112857 CCCACGGAGAGATTCGTTTA Chr5:93112750..93112769 60.07 50
upstream ENSMUSE00000321238 Chr5:93209779..93209933 AAGCTGGGGACGAAGTCATA Chr5:93209822..93209841 59.69 50
upstream ENSMUSE00000694089 Chr5:93238414..93238587 ACCAGCTCGACTGTGTGTCA Chr5:93238501..93238520 60.53 55
upstream ENSMUSE00000694084 Chr5:93327024..93327246 No primer for this exon
upstream ENSMUSE00000321233 Chr5:93348671..93348802 AGAGCTGCTCACCTGCAGTC Chr5:93348728..93348747 60.92 60
upstream ENSMUSE00000694088 Chr5:93348671..93348802 AGAGCTGCTCACCTGCAGTC Chr5:93348728..93348747 60.92 60
upstream ENSMUSE00000321231 Chr5:93362780..93362911 CTTGGCACCAGAGCTACCAT Chr5:93362887..93362906 60.28 55
upstream ENSMUSE00000694087 Chr5:93362780..93362911 CTTGGCACCAGAGCTACCAT Chr5:93362887..93362906 60.28 55
upstream ENSMUSE00000694094 Chr5:93369003..93372165 CAGCTGCATACAGTCCCAGA Chr5:93369709..93369728 60.01 55
upstream ENSMUSE00000188405 Chr5:93377430..93377503 GAAGGCAGCAACTTTGGTTT Chr5:93377445..93377464 59.36 45
upstream ENSMUSE00000188402 Chr5:93379510..93380346 GCACCCCAAGGTTACTTCAA Chr5:93380170..93380189 59.97 50
upstream ENSMUSE00000321188 Chr5:93381565..93382056 ATAGTGGCGCAAAGAGGAAA Chr5:93381993..93382012 59.85 45
upstream ENSMUSE00000321182 Chr5:93384287..93384437 ACCACAAGGAGGCAGTGAGT Chr5:93384292..93384311 59.76 55

*** Putative Vector Insertion (Chr 5: 93384438 - 93391116) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000321177 Chr5:93391117..93391389 TTCAGCTTGATGTCCGTGAG Chr5:93391202..93391221 59.98 50
downstream ENSMUSE00000483674 Chr5:93393382..93394785 TTGCCTACATCCACCACAAA Chr5:93394287..93394306 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTAGGGTGGGGACACTT Chr5:93390436..93390456 59.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTAAAAGGCCGTGACTGG Chr5:93390478..93390498 59.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029381