Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4770
Trapped Gene
Qk (ENSMUSG00000062078)
Vector Insertion
Chr 17: 10410669 - 10431757
Public Clones AW0612 (sanger) P107F03 (ggtc) P107F03 (ggtc) P107F03 (ggtc)
Private Clones OST432404 (lexicon)
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000269810 (Chr17:10431758..10431901 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGAAGAGAGCGGTTGAAG Chr17:10431784..10431803 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000269810 (Chr17:10431758..10431901 -)
Downstram Exon
ENSMUSE00000434071 (Chr17:10410581..10410668 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGAAGAGAGCGGTTGAAG Chr17:10431784..10431803 60.28 55 TGTTGGCGTCTCTGTAGGTG Chr17:10410568..10410587 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000658322 Chr17:10512187..10512315 CCTGAACTGAGGCGAACTCC Chr17:10512220..10512239 62.28 60
upstream ENSMUSE00000569062 Chr17:10511597..10512245 GCAGCTGATGAACGACAAGA Chr17:10511663..10511682 60.14 50
upstream ENSMUSE00000658321 Chr17:10511597..10511758 GCAGCTGATGAACGACAAGA Chr17:10511663..10511682 60.14 50
upstream ENSMUSE00000658325 Chr17:10511597..10511738 GCAGCTGATGAACGACAAGA Chr17:10511663..10511682 60.14 50
upstream ENSMUSE00000269846 Chr17:10475704..10475846 GTGGGACCCATTGTTCAGTT Chr17:10475744..10475763 59.68 50
upstream ENSMUSE00000269819 Chr17:10466812..10466928 TTTGTTGGGAGAATCCTTGG Chr17:10466903..10466922 59.9 45
upstream ENSMUSE00000269810 Chr17:10431758..10431901 GCTGAAGAGAGCGGTTGAAG Chr17:10431784..10431803 60.28 55

*** Putative Vector Insertion (Chr 17: 10410669 - 10431757) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434071 Chr17:10410581..10410668 TGTTGGCGTCTCTGTAGGTG Chr17:10410568..10410587 59.9 55
downstream ENSMUSE00000434057 Chr17:10409025..10409324 TGTAGCTGGTGCCAATGTGT Chr17:10409043..10409062 60.18 50
downstream ENSMUSE00000658324 Chr17:10406224..10406298 GTCTGCGGTCACAATCCTTT Chr17:10406206..10406225 60.12 50
downstream ENSMUSE00000703889 Chr17:10405459..10405472 No primer for this exon
downstream ENSMUSE00000508229 Chr17:10403055..10408339 ACTTTTTGGACACCCAGCAC Chr17:10406146..10406165 60.01 50
downstream ENSMUSE00000351504 Chr17:10403044..10407059 ACTTTTTGGACACCCAGCAC Chr17:10406146..10406165 60.01 50
downstream ENSMUSE00000658323 Chr17:10401473..10402496 GCATGATGCATTGTCACACA Chr17:10402008..10402027 60.13 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTATAATCGCCTTGCAGCAC Chr17:10410689..10410709 58.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTTTTAGCGTGACTGGGAAA Chr17:10410693..10410714 58.89 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TATTAATCGCCTTGCAGCAC Chr17:10410834..10410854 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGAAAATCGTGACTGGGAAA Chr17:10410838..10410859 60.1 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062078