Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4773
Trapped Gene
Pdcl (ENSMUSG00000009030)
Vector Insertion
Chr 2: 37207903 - 37211155
Public Clones AW0599 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000164027 (Chr2:37211156..37211337 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000164027 (Chr2:37211156..37211337 -)
Downstram Exon
ENSMUSE00000693704 (Chr2:37206108..37207902 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000603387 Chr2:37214663..37214741 No primer for this exon
upstream ENSMUSE00000693705 Chr2:37213872..37214773 No primer for this exon
upstream ENSMUSE00000164023 Chr2:37212724..37212900 No primer for this exon
upstream ENSMUSE00000709080 Chr2:37212724..37212900 No primer for this exon
upstream ENSMUSE00000164027 Chr2:37211156..37211337 No primer for this exon

*** Putative Vector Insertion (Chr 2: 37207903 - 37211155) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693704 Chr2:37206108..37207902 No primer for this exon
downstream ENSMUSE00000341216 Chr2:37205596..37207902 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACCTCCAGGAGAAAATCA Chr2:37211162..37211182 59.06 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAAGGACCTCCAGGAGAA Chr2:37211167..37211187 59.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009030