Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4777
Trapped Gene
Ppp2r1a (ENSMUSG00000007564)
Vector Insertion
Chr 17: 21082548 - 21088306
Public Clones AW0556 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000323583 (Chr17:21082459..21082547 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000323583 (Chr17:21082459..21082547 +)
Downstram Exon
ENSMUSE00000323554 (Chr17:21088307..21088397 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000323583 Chr17:21082459..21082547 No primer for this exon

*** Putative Vector Insertion (Chr 17: 21082548 - 21088306) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000323554 Chr17:21088307..21088397 No primer for this exon
downstream ENSMUSE00000554571 Chr17:21091579..21091679 No primer for this exon
downstream ENSMUSE00000135746 Chr17:21092752..21092984 No primer for this exon
downstream ENSMUSE00000135758 Chr17:21093669..21093816 No primer for this exon
downstream ENSMUSE00000554564 Chr17:21093921..21094076 No primer for this exon
downstream ENSMUSE00000135759 Chr17:21095684..21095798 No primer for this exon
downstream ENSMUSE00000135760 Chr17:21095904..21095974 No primer for this exon
downstream ENSMUSE00000554559 Chr17:21096353..21096487 No primer for this exon
downstream ENSMUSE00000135750 Chr17:21097430..21097603 No primer for this exon
downstream ENSMUSE00000554554 Chr17:21097917..21097977 No primer for this exon
downstream ENSMUSE00000554545 Chr17:21098549..21098703 No primer for this exon
downstream ENSMUSE00000449295 Chr17:21099538..21099680 No primer for this exon
downstream ENSMUSE00000135747 Chr17:21102203..21102294 No primer for this exon
downstream ENSMUSE00000350877 Chr17:21102419..21102864 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTCAGGTACGGGGATCCTT Chr17:21085543..21085563 60.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTACGTGACTGGGAAAACC Chr17:21085595..21085615 59.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007564