Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4783
Trapped Gene
Taf12 (ENSMUSG00000028899)
Vector Insertion
Chr 4: 131847867 - 131848541
Public Clones AW0174 (sanger) (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000373585 (Chr4:131847778..131847866 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATGTACCACAGAGGCTCA Chr4:131847840..131847859 59.86 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000373585 (Chr4:131847778..131847866 +)
Downstram Exon
ENSMUSE00000668041 (Chr4:131848542..131848627 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATGTACCACAGAGGCTCA Chr4:131847840..131847859 59.86 55 TGGTTGTTTTCCGGATCAGT Chr4:131848572..131848591 60.35 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414762 Chr4:131830328..131830402 CTGCTGAGACGAAAGCTTCA Chr4:131830338..131830357 59.47 50
upstream ENSMUSE00000668044 Chr4:131830331..131830402 CTGCTGAGACGAAAGCTTCA Chr4:131830338..131830357 59.47 50
upstream ENSMUSE00000668043 Chr4:131837909..131837993 CAGTGGGCTTACAGCAGTTG Chr4:131837939..131837958 59.51 55
upstream ENSMUSE00000183257 Chr4:131838709..131838960 AGCGCTAATCAACCTCTCCA Chr4:131838813..131838832 59.98 50
upstream ENSMUSE00000668042 Chr4:131838709..131838960 AGCGCTAATCAACCTCTCCA Chr4:131838813..131838832 59.98 50
upstream ENSMUSE00000381198 Chr4:131840959..131841036 CCTAATGAGCAGCTGGATGA Chr4:131841004..131841023 58.98 50
upstream ENSMUSE00000338088 Chr4:131845230..131845344 ATGCTGCTACAGATCGCTGA Chr4:131845230..131845249 59.73 50
upstream ENSMUSE00000373585 Chr4:131847778..131847866 GCATGTACCACAGAGGCTCA Chr4:131847840..131847859 59.86 55

*** Putative Vector Insertion (Chr 4: 131847867 - 131848541) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000333148 Chr4:131848542..131849006 TGGTTGTTTTCCGGATCAGT Chr4:131848572..131848591 60.35 45
downstream ENSMUSE00000668041 Chr4:131848542..131848627 TGGTTGTTTTCCGGATCAGT Chr4:131848572..131848591 60.35 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGAGGCTCACAAACAGGTG Chr4:131847851..131847871 59.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAGGCTCACAAACAGGTG Chr4:131847851..131847871 59.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028899