Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4787
Trapped Gene
Trim59 (ENSMUSG00000034317)
Vector Insertion
Chr 3: 68841931 - 68847689
Public Clones AW0141 (sanger) SYA173 (baygenomics) P010D06 (ggtc) FHCRC-GT-S20-5G1 (fhcrc)
PST14529-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674481 (Chr3:68847690..68847764 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674481 (Chr3:68847690..68847764 -)
Downstram Exon
ENSMUSE00000487464 (Chr3:68839210..68841930 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86 AGCCAGCAGTCCAGACACTT Chr3:68840053..68840072 60.06 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674482 Chr3:68848535..68848677 No primer for this exon
upstream ENSMUSE00000229097 Chr3:68847690..68847765 AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86
upstream ENSMUSE00000674481 Chr3:68847690..68847764 AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86

*** Putative Vector Insertion (Chr 3: 68841931 - 68847689) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000462170 Chr3:68839215..68841930 AGCCAGCAGTCCAGACACTT Chr3:68840053..68840072 60.06 55
downstream ENSMUSE00000487464 Chr3:68839210..68841930 AGCCAGCAGTCCAGACACTT Chr3:68840053..68840072 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGGTAAGCTCTGGGAAGT Chr3:68844672..68844692 58.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCACAGGTACAGAGCGTGA Chr3:68844633..68844653 59.65 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGAGTGTGGGGCTTTGTCT Chr3:68841736..68841756 61.08 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCATAGACGTGACTGGGAAA Chr3:68841701..68841721 58.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034317