Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4792
Trapped Gene
AC144621.3-201 (ENSMUSG00000024301)
Vector Insertion
Chr 17: 27063241 - 27069048
Public Clones AW0100 (sanger) IST10265H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000474866 (Chr17:27063165..27063240 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCACTACGCTTTGCTTCCA Chr17:27063219..27063238 59.61 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000474866 (Chr17:27063165..27063240 +)
Downstram Exon
ENSMUSE00000707388 (Chr17:27069049..27069093 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCACTACGCTTTGCTTCCA Chr17:27063219..27063238 59.61 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610513 Chr17:27054036..27054230 CCTTTGCATCCCTTCCTGTG Chr17:27054184..27054203 62.87 55
upstream ENSMUSE00000449874 Chr17:27057742..27057876 GTCAAGTCCTCCTCCCGACT Chr17:27057790..27057809 60.65 60
upstream ENSMUSE00000657969 Chr17:27057850..27057876 No primer for this exon
upstream ENSMUSE00000657976 Chr17:27057965..27058064 GGTGCAGTGACCAAAGTTGA Chr17:27057983..27058002 59.73 50
upstream ENSMUSE00000503606 Chr17:27058752..27058805 GGTGCTCTGCTGTTGGTACA Chr17:27058785..27058804 59.9 55
upstream ENSMUSE00000657975 Chr17:27059621..27059668 GAGGAGCCAGAAGCCAGCTC Chr17:27059625..27059644 63.96 65
upstream ENSMUSE00000450692 Chr17:27059850..27060094 GTTGAAACGCTATCGGGAGA Chr17:27059938..27059957 60.21 50
upstream ENSMUSE00000657974 Chr17:27059850..27060247 GCTGGAGGAATGTCTGGGTA Chr17:27060136..27060155 60.07 55
upstream ENSMUSE00000478428 Chr17:27060160..27060213 GCTGCTTCAGGAGCTTCAGG Chr17:27060166..27060185 62.68 60
upstream ENSMUSE00000478480 Chr17:27060218..27060247 No primer for this exon
upstream ENSMUSE00000467416 Chr17:27060954..27061733 AGACCGTTCGAGACCTGCTA Chr17:27061597..27061616 60.01 55
upstream ENSMUSE00000519682 Chr17:27062387..27062677 GACACAGGCCATTAACAGCA Chr17:27062614..27062633 59.72 50
upstream ENSMUSE00000490427 Chr17:27062771..27062844 TTACCGAAACAGCAAGCTCA Chr17:27062785..27062804 59.61 45
upstream ENSMUSE00000474866 Chr17:27063165..27063240 TTCACTACGCTTTGCTTCCA Chr17:27063219..27063238 59.61 45

*** Putative Vector Insertion (Chr 17: 27063241 - 27069048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000701228 Chr17:27069049..27069524 AGGACCTGAAGCCCTGTTCT Chr17:27069355..27069374 60.25 55
downstream ENSMUSE00000707388 Chr17:27069049..27069093 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGGAGATGGGTCTGTTT Chr17:27066252..27066272 59.51 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGGAGATGGGTCTGTTT Chr17:27066252..27066272 59.51 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024301