Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4823
Trapped Gene
Ccnb2 (ENSMUSG00000032218)
Vector Insertion
Chr 9: 70266937 - 70269223
Public Clones (sanger) AM0784 (sanger)
Private Clones OST300161 (lexicon) OST163968 (lexicon) OST163948 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000406066 (Chr9:70269224..70269354 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000406066 (Chr9:70269224..70269354 -)
Downstram Exon
ENSMUSE00000217822 (Chr9:70266808..70266936 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCCACCTGAGTGGTTCTGTT Chr9:70266790..70266809 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406066 Chr9:70269224..70269354 No primer for this exon

*** Putative Vector Insertion (Chr 9: 70266937 - 70269223) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217822 Chr9:70266808..70266936 GCCACCTGAGTGGTTCTGTT Chr9:70266790..70266809 60.16 55
downstream ENSMUSE00000217820 Chr9:70266601..70266714 CTGCACTGGTTTCACAGAGG Chr9:70266600..70266619 59.46 55
downstream ENSMUSE00000217823 Chr9:70260909..70261079 GCAGAGGCTCTCTTCCTTCA Chr9:70261007..70261026 59.83 55
downstream ENSMUSE00000217818 Chr9:70260649..70260807 CAGAAGCCGAAACTTGGAAT Chr9:70260675..70260694 59.31 45
downstream ENSMUSE00000217821 Chr9:70258462..70258698 TTTCTCGGATTTGGGAACTG Chr9:70258529..70258548 60.04 45
downstream ENSMUSE00000217829 Chr9:70257928..70258068 AGCGTCAGCTCCATCAGGTA Chr9:70257997..70258016 60.97 55
downstream ENSMUSE00000318721 Chr9:70257087..70257197 GCTGCATGACTTCCAGGACT Chr9:70257115..70257134 60.42 55
downstream ENSMUSE00000217819 Chr9:70255499..70255836 GAGGGATCGTGCTGATCTTC Chr9:70255760..70255779 59.77 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr9:70269153..70269173 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAATCGCCTTGCAGCACAT Chr9:70269285..70269305 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 CTGCGTGCGTCTACCCAATA Chr9:70269375..70269395 62.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032218