Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4824
Trapped Gene
Stag2 (ENSMUSG00000025862)
Vector Insertion
Chr X: 39622685 - 39624421
Public Clones AM0770 (sanger)
Private Clones OST184924 (lexicon)
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000153661 (ChrX:39622558..39622684 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGTGGTACAAGCCTAATGG ChrX:39622561..39622580 60.52 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000153661 (ChrX:39622558..39622684 +)
Downstram Exon
ENSMUSE00000328097 (ChrX:39624422..39624499 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGTGGTACAAGCCTAATGG ChrX:39622561..39622580 60.52 55 TCAAAGAAATCGGGCTTCAG ChrX:39624477..39624496 60.32 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701656 ChrX:39502589..39502862 GCTTCCGTCCCTCAGTAGAA ChrX:39502705..39502724 59.43 55
upstream ENSMUSE00000701611 ChrX:39503878..39504011 GTTGGCATCGATCTCTCCAT ChrX:39503970..39503989 60.04 50
upstream ENSMUSE00000328276 ChrX:39555032..39555171 ACATTGGGGTGATCCAGAAG ChrX:39555097..39555116 59.78 50
upstream ENSMUSE00000328268 ChrX:39559223..39559301 AATCAGAAGCAAGGCAAAGG ChrX:39559278..39559297 59.45 45
upstream ENSMUSE00000442132 ChrX:39564255..39564419 ACCGAATGAACGGTCATCAT ChrX:39564334..39564353 60.2 45
upstream ENSMUSE00000153687 ChrX:39570512..39570608 GGACATAGCGCTTCTTGACC ChrX:39570553..39570572 59.84 55
upstream ENSMUSE00000153668 ChrX:39574155..39574231 No primer for this exon
upstream ENSMUSE00000555738 ChrX:39576423..39576627 TGGGGATTACCCACTTACCA ChrX:39576428..39576447 60.04 50
upstream ENSMUSE00000555737 ChrX:39578105..39578256 TTGGAAAACGAGCTAACGAAA ChrX:39578204..39578224 59.88 38.1
upstream ENSMUSE00000555735 ChrX:39579966..39580039 No primer for this exon
upstream ENSMUSE00000153674 ChrX:39581388..39581511 TGAAGAGATTGGCATTTGGA ChrX:39581421..39581440 59.2 40
upstream ENSMUSE00000153673 ChrX:39582301..39582399 No primer for this exon
upstream ENSMUSE00000153679 ChrX:39582496..39582575 No primer for this exon
upstream ENSMUSE00000328202 ChrX:39587048..39587155 GTAGCAGTTGCAGCTGGAGAA ChrX:39587121..39587141 60.72 52.38
upstream ENSMUSE00000153677 ChrX:39587823..39587934 GGATGGGCTGATGAAAAGAA ChrX:39587850..39587869 60.01 45
upstream ENSMUSE00000555727 ChrX:39589466..39589583 CATGCAGCTTACCTTGTGGA ChrX:39589475..39589494 59.86 50
upstream ENSMUSE00000411112 ChrX:39590128..39590231 GGGAAGAGGGACAGGAAAAA ChrX:39590210..39590229 60.41 50
upstream ENSMUSE00000392880 ChrX:39600143..39600235 GGCCCTTCCGCAGTTATTAG ChrX:39600211..39600230 60.94 55
upstream ENSMUSE00000153666 ChrX:39600356..39600445 AAGGTGACCAATTTGTTGCAG ChrX:39600374..39600394 60.02 42.86
upstream ENSMUSE00000153680 ChrX:39601027..39601230 CGCCAGATCCGAAATATTGTA ChrX:39601045..39601065 59.94 42.86
upstream ENSMUSE00000153669 ChrX:39603182..39603252 CAACATTGAAGAGGATCACTGC ChrX:39603222..39603243 59.74 45.46
upstream ENSMUSE00000555719 ChrX:39603509..39603596 CTTGAAAACCGGAATCGAAA ChrX:39603557..39603576 60.05 40
upstream ENSMUSE00000153665 ChrX:39603698..39603778 TTGGCAGCTTGCTAAGATCA ChrX:39603739..39603758 59.71 45
upstream ENSMUSE00000153667 ChrX:39606231..39606323 CAGCATTACTTGACCAACGTG ChrX:39606282..39606302 59.26 47.62
upstream ENSMUSE00000153672 ChrX:39606854..39607028 GGAGGGCGTGACATGTTAGA ChrX:39606908..39606927 61.07 55
upstream ENSMUSE00000153663 ChrX:39610032..39610171 TACCGTGGTGGAGATGAACA ChrX:39610120..39610139 59.96 50
upstream ENSMUSE00000555712 ChrX:39611203..39611304 No primer for this exon
upstream ENSMUSE00000153671 ChrX:39612532..39612680 TCGGCGTTTTGCTTTAACTT ChrX:39612612..39612631 59.89 40
upstream ENSMUSE00000153681 ChrX:39613781..39613909 TTCTAAACTGCTCCGACAGGA ChrX:39613877..39613897 60 47.62
upstream ENSMUSE00000153675 ChrX:39615836..39616059 AGTCGGGGATCAACTGTACG ChrX:39615975..39615994 59.99 55
upstream ENSMUSE00000153685 ChrX:39619263..39619452 GAACACCATCAAACGCCTCT ChrX:39619424..39619443 60.12 50
upstream ENSMUSE00000701623 ChrX:39619543..39619653 AGGAGAGAGCAGCAATGAGC ChrX:39619599..39619618 59.86 55
upstream ENSMUSE00000153661 ChrX:39622558..39622684 GCGTGGTACAAGCCTAATGG ChrX:39622561..39622580 60.52 55

*** Putative Vector Insertion (Chr X: 39622685 - 39624421) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000328097 ChrX:39624422..39624499 TCAAAGAAATCGGGCTTCAG ChrX:39624477..39624496 60.32 45
downstream ENSMUSE00000328090 ChrX:39628440..39630352 CCTAAGCCTCGCAAAATGAG ChrX:39629752..39629771 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGGGAATGGACTTTGACAC ChrX:39622649..39622670 59.96 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAACGTGACTGGGAAAACC ChrX:39622732..39622752 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025862