Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4825
Trapped Gene
AC122253.5 (ENSMUSG00000024095)
Vector Insertion
Chr 17: 80434793 - 80437931
Public Clones AM0758 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000253163 (Chr17:80437932..80438149 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGTCCGCTACTGCCTTTA Chr17:80438124..80438143 59.73 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000253163 (Chr17:80437932..80438149 -)
Downstram Exon
ENSMUSE00000253146 (Chr17:80434671..80434792 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGTCCGCTACTGCCTTTA Chr17:80438124..80438143 59.73 50 TTCCACAGCGTACTCGTCAC Chr17:80434705..80434724 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000504264 Chr17:80460997..80461608 CCAAGGAGGAGACGTACGAG Chr17:80461288..80461307 59.86 60
upstream ENSMUSE00000138333 Chr17:80452863..80452981 TGTTGTGGAAGCTGACCTTG Chr17:80452894..80452913 59.87 50
upstream ENSMUSE00000138335 Chr17:80449968..80450205 AATACCGACGATCCATCAGG Chr17:80450023..80450042 59.77 50
upstream ENSMUSE00000138329 Chr17:80449147..80449232 TGTATGCAACCCTGTTGGAA Chr17:80449199..80449218 59.96 45
upstream ENSMUSE00000138322 Chr17:80448105..80448201 CCGGATGTTGCACACTAAAA Chr17:80448120..80448139 59.58 45
upstream ENSMUSE00000138327 Chr17:80447948..80448020 No primer for this exon
upstream ENSMUSE00000138323 Chr17:80443834..80443905 GGGAGACCATCCTTCTTCGT Chr17:80443852..80443871 60.46 55
upstream ENSMUSE00000253163 Chr17:80437932..80438149 ATGGTCCGCTACTGCCTTTA Chr17:80438124..80438143 59.73 50

*** Putative Vector Insertion (Chr 17: 80434793 - 80437931) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000253146 Chr17:80434671..80434792 TTCCACAGCGTACTCGTCAC Chr17:80434705..80434724 59.9 55
downstream ENSMUSE00000253131 Chr17:80433386..80433587 GTGACACACAGCGGAACATT Chr17:80433383..80433402 59.6 50
downstream ENSMUSE00000253111 Chr17:80432068..80432125 GAACGGAAGAACTTCGTGGT Chr17:80432074..80432093 59.19 50
downstream ENSMUSE00000253095 Chr17:80431881..80431979 AGTGATTGAGCGCAGTGAGA Chr17:80431877..80431896 59.73 50
downstream ENSMUSE00000490045 Chr17:80429683..80429880 GCAAGGCAACATTAGACCAA Chr17:80429702..80429721 58.77 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAACCTGTTCTGCTTGTATGG Chr17:80434943..80434965 60.17 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACGTGACTGGGAAAACC Chr17:80434864..80434884 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024095