Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4828
Trapped Gene
Prune (ENSMUSG00000015711)
Vector Insertion
Chr 3: 95072246 - 95085506
Public Clones (sanger) (sanger) AL0655 (sanger) (sanger) (sanger) RRM146 (baygenomics)
RRM388 (baygenomics) D096B07 (ggtc) (ggtc) D068A04 (ggtc) (ggtc)
P142D03 (ggtc) (ggtc) D091G10 (ggtc) (ggtc) D068A04 (ggtc) E133C08 (ggtc)
(ggtc) D086G12 (ggtc) 5SE047H07 (ggtc) (ggtc) CMHD-GT_387B2-3 (cmhd)
(cmhd) CMHD-GT_517B12-3 (cmhd) CMHD-GT_337A9-3 (cmhd) (cmhd)
FHCRC-GT-S1-8C1 (fhcrc) FHCRC-GT-S8-2C2 (fhcrc) IST14458F11 (tigm) IST14292D8 (tigm)
IST12530H12 (tigm) IST12530H12 (tigm) IST10118C6 (tigm) IST12765H3 (tigm)
IST11027E1 (tigm) IST13181D7 (tigm) IST12454H12 (tigm) IST14261F5 (tigm)
IST10438C8 (tigm) IST14162B2 (tigm) IST14458F11 (tigm) IST10358C6 (tigm)
IST10259G8 (tigm) IST13658C3 (tigm) IST12962B6 (tigm) IST13669C8 (tigm)
IST10006D6 (tigm) IST12053E6 (tigm) IST10956C5 (tigm) IST12251D11 (tigm)
IST13886E9 (tigm) IST12678D1 (tigm) IST14046F7 (tigm) IST12659F7 (tigm)
IST10080E11 (tigm) IST12678D1 (tigm) IST14252D6 (tigm) IST10956C5 (tigm)
IST13243F7 (tigm) IST13248H8 (tigm) IST13658C3 (tigm) IST10438D8 (tigm)
IST13623H3 (tigm)
Private Clones OST461702 (lexicon) OST456077 (lexicon) OST447956 (lexicon) OST444235 (lexicon)
OST422957 (lexicon) OST401510 (lexicon) OST392805 (lexicon) OST389991 (lexicon)
OST388761 (lexicon) OST388401 (lexicon) OST385779 (lexicon) OST369825 (lexicon)
OST338887 (lexicon) OST335698 (lexicon) OST330199 (lexicon) OST309334 (lexicon)
OST289900 (lexicon) OST289288 (lexicon) OST286450 (lexicon) OST286179 (lexicon)
OST285428 (lexicon) OST285110 (lexicon) OST267890 (lexicon) OST261105 (lexicon)
OST260686 (lexicon) OST253315 (lexicon) OST251753 (lexicon) OST248875 (lexicon)
OST242635 (lexicon) OST237300 (lexicon) OST232394 (lexicon) OST214892 (lexicon)
OST208332 (lexicon) OST204251 (lexicon) OST192966 (lexicon) OST189682 (lexicon)
OST184204 (lexicon) OST179770 (lexicon) OST178820 (lexicon) OST169210 (lexicon)
OST168490 (lexicon) OST167913 (lexicon) OST153817 (lexicon) OST145323 (lexicon)
OST135277 (lexicon) OST132517 (lexicon) OST129761 (lexicon) OST129665 (lexicon)
OST128875 (lexicon) OST122825 (lexicon) OST118918 (lexicon) OST95885 (lexicon)
OST91477 (lexicon) OST87586 (lexicon) OST78146 (lexicon) OST77150 (lexicon)
OST59530 (lexicon) OST56926 (lexicon) OST54648 (lexicon) OST52871 (lexicon)
OST45523 (lexicon) OST37610 (lexicon) OST30767 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000391391 (Chr3:95085507..95085998 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000391391 (Chr3:95085507..95085998 -)
Downstram Exon
ENSMUSE00000332225 (Chr3:95072153..95072245 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000391391 Chr3:95085507..95085998 No primer for this exon

*** Putative Vector Insertion (Chr 3: 95072246 - 95085506) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000332225 Chr3:95072153..95072245 No primer for this exon
downstream ENSMUSE00000253496 Chr3:95069340..95069542 No primer for this exon
downstream ENSMUSE00000253487 Chr3:95067514..95067698 No primer for this exon
downstream ENSMUSE00000253477 Chr3:95066133..95066291 No primer for this exon
downstream ENSMUSE00000176370 Chr3:95063162..95063256 No primer for this exon
downstream ENSMUSE00000253465 Chr3:95061949..95062107 No primer for this exon
downstream ENSMUSE00000413523 Chr3:95057597..95059349 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCTTTACCATGGAGGACTA Chr3:95076533..95076554 60.33 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTACCTGCAGGACTGTCGAG Chr3:95085516..95085537 59.53 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCTTTAGATTTAATCGCCTTGC Chr3:95076936..95076958 59.3 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACGGTAGTCGTGACTGGGAAA Chr3:95085935..95085956 61.86 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015711