Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI483
Trapped Gene
Nufip2 (ENSMUSG00000037857)
Vector Insertion
Chr 11: 77519044 - 77523184
Public Clones DB0054 (sanger) RRN063 (baygenomics) HMA391 (baygenomics) PST15481-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000292185 (Chr11:77519011..77519043 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000292185 (Chr11:77519011..77519043 +)
Downstram Exon
ENSMUSE00000650373 (Chr11:77523185..77524259 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ATGAACGGTGGCTCTAATGC Chr11:77523293..77523312 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000292202 Chr11:77499641..77500009 AGCAGCCTCACCAATACCTG Chr11:77499887..77499906 60.28 55
upstream ENSMUSE00000292192 Chr11:77505044..77506756 GAACTCCTCCGTGTCACCAT Chr11:77505876..77505895 59.97 55
upstream ENSMUSE00000292185 Chr11:77519011..77519043 No primer for this exon

*** Putative Vector Insertion (Chr 11: 77519044 - 77523184) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000650373 Chr11:77523185..77524259 ATGAACGGTGGCTCTAATGC Chr11:77523293..77523312 60.1 50
downstream ENSMUSE00000650374 Chr11:77555188..77555294 ACCAATGTAACGCCAGTTCC Chr11:77555292..77555311 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTAATCGCCTTGCAGCAC Chr11:77522092..77522112 60.78 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGTTCGTGACTGGGAAAA Chr11:77522089..77522109 59.15 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037857