Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI486
Trapped Gene
Akap12 (ENSMUSG00000038587)
Vector Insertion
Chr 10: 5993400 - 6032683
Public Clones DB0016 (sanger) DB0032 (sanger) (sanger) DB0008 (sanger) XS0076 (sanger)
DB0007 (sanger) XE450 (baygenomics) XG216 (baygenomics) E038F09 (ggtc)
D053B08 (ggtc) (ggtc) D063F05 (ggtc) W007E10 (ggtc) D053B08 (ggtc)
(ggtc) D063F05 (ggtc) CMHD-GT_305C12-3 (cmhd) CMHD-GT_311G03-3 (cmhd) CMHD-GT_297D2-3 (cmhd)
CMHD-GT_272E7-3 (cmhd) CMHD-GT_330C11-3 (cmhd) CMHD-GT_280E9-3 (cmhd) CMHD-GT_264H01-3 (cmhd)
IST15052H3 (tigm) IST14922B5 (tigm) IST15033H11 (tigm) IST14881G4 (tigm)
IST12840A2 (tigm)
Private Clones OST449280 (lexicon) OST403430 (lexicon) OST386099 (lexicon) OST378742 (lexicon)
OST247095 (lexicon) OST182948 (lexicon) OST53891 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000490750 (Chr10:6032684..6032798 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATGTCCACGTCCAAGAGG Chr10:6032726..6032745 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000490750 (Chr10:6032684..6032798 -)
Downstram Exon
ENSMUSE00000577414 (Chr10:5991352..5993399 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATGTCCACGTCCAAGAGG Chr10:6032726..6032745 60.11 55 TGTGGATTGCTTCAGCTCAC Chr10:5992977..5992996 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000491803 Chr10:6079873..6080178 ACCCCTTAGTCCCTGTGGTC Chr10:6080107..6080126 60.23 60
upstream ENSMUSE00000490750 Chr10:6032684..6032798 AGATGTCCACGTCCAAGAGG Chr10:6032726..6032745 60.11 55

*** Putative Vector Insertion (Chr 10: 5993400 - 6032683) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000577414 Chr10:5991352..5993399 TGTGGATTGCTTCAGCTCAC Chr10:5992977..5992996 59.99 50
downstream ENSMUSE00000577421 Chr10:5991159..5991350 CCGCATCGTACTCAGACAGA Chr10:5991140..5991159 60.01 55
downstream ENSMUSE00000519058 Chr10:5988602..5993399 CCGCATCGTACTCAGACAGA Chr10:5991140..5991159 60.01 55
downstream ENSMUSE00000515563 Chr10:5987073..5988063 TTTGGTCTCAAGGTCCCAAC Chr10:5987969..5987988 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCGACATGATTGTGAGAAA Chr10:6020673..6020693 59.65 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCGACATGATTGTGAGAAA Chr10:6020673..6020693 59.65 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAGGCCGTACACGCTGAGTT Chr10:6002784..6002804 60.85 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTGCTGATGTGACTCTGGA Chr10:6020789..6020809 59.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038587