Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4867
Trapped Gene
AC144621.3-201 (ENSMUSG00000024301)
Vector Insertion
Chr 17: 27054231 - 27057849
Public Clones AE0727 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000610513 (Chr17:27054036..27054230 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTTGCATCCCTTCCTGTG Chr17:27054184..27054203 62.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000610513 (Chr17:27054036..27054230 +)
Downstram Exon
ENSMUSE00000657969 (Chr17:27057850..27057876 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTTGCATCCCTTCCTGTG Chr17:27054184..27054203 62.87 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610513 Chr17:27054036..27054230 CCTTTGCATCCCTTCCTGTG Chr17:27054184..27054203 62.87 55

*** Putative Vector Insertion (Chr 17: 27054231 - 27057849) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000449874 Chr17:27057742..27057876 CCGCCTTCAGTTCTACGTTC Chr17:27057787..27057806 59.88 55
downstream ENSMUSE00000657969 Chr17:27057850..27057876 No primer for this exon
downstream ENSMUSE00000657976 Chr17:27057965..27058064 GGACGGGATGTGTCAACTTT Chr17:27058017..27058036 59.83 50
downstream ENSMUSE00000503606 Chr17:27058752..27058805 CCACCAGGTCCTGTCTTCTT Chr17:27058788..27058807 59.15 55
downstream ENSMUSE00000657975 Chr17:27059621..27059668 No primer for this exon
downstream ENSMUSE00000450692 Chr17:27059850..27060094 CCAGCGTTTCAGTCTTCTCC Chr17:27059975..27059994 59.99 55
downstream ENSMUSE00000657974 Chr17:27059850..27060247 CCAGCGTTTCAGTCTTCTCC Chr17:27059975..27059994 59.99 55
downstream ENSMUSE00000478428 Chr17:27060160..27060213 CTCTCCCTGAAGCTCCTGAA Chr17:27060193..27060212 59.67 55
downstream ENSMUSE00000478480 Chr17:27060218..27060247 No primer for this exon
downstream ENSMUSE00000467416 Chr17:27060954..27061733 TAGCAGGTCTCGAACGGTCT Chr17:27061619..27061638 60.01 55
downstream ENSMUSE00000519682 Chr17:27062387..27062677 TGCTGTTAATGGCCTGTGTC Chr17:27062636..27062655 59.72 50
downstream ENSMUSE00000490427 Chr17:27062771..27062844 TGAGCTTGCTGTTTCGGTAA Chr17:27062807..27062826 59.61 45
downstream ENSMUSE00000474866 Chr17:27063165..27063240 TGGAAGCAAAGCGTAGTGAAT Chr17:27063240..27063260 59.9 42.86
downstream ENSMUSE00000701228 Chr17:27069049..27069524 AGGACCTGAAGCCCTGTTCT Chr17:27069355..27069374 60.25 55
downstream ENSMUSE00000707388 Chr17:27069049..27069093 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTTGCATCCCTTCCTGTG Chr17:27057185..27057205 62.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGTCGTGACTGGGAAAAC Chr17:27057277..27057297 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024301