Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4890
Trapped Gene
Sall4 (ENSMUSG00000027547)
Vector Insertion
Chr 2: 168581265 - 168582301
Public Clones AT0337 (sanger) RRC044 (baygenomics) XE027 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661187 (Chr2:168581266..168582300 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCAGCAAGTGTCCGTGTC Chr2:168581622..168581641 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661187 (Chr2:168581266..168582300 -)
Downstram Exon
ENSMUSE00000679262 (Chr2:168581266..168582300 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCAGCAAGTGTCCGTGTC Chr2:168581622..168581641 60.03 55 GACACGGACACTTGCTGAGA Chr2:168581600..168581619 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708679 Chr2:168592412..168592701 AGCACATCAACTGGGAGGAG Chr2:168592482..168592501 60.26 55
upstream ENSMUSE00000711707 Chr2:168592412..168592701 AGCACATCAACTGGGAGGAG Chr2:168592482..168592501 60.26 55
upstream ENSMUSE00000719112 Chr2:168592412..168592701 AGCACATCAACTGGGAGGAG Chr2:168592482..168592501 60.26 55
upstream ENSMUSE00000679259 Chr2:168590594..168590618 No primer for this exon
upstream ENSMUSE00000661187 Chr2:168581266..168582300 TCTCAGCAAGTGTCCGTGTC Chr2:168581622..168581641 60.03 55
upstream ENSMUSE00000679262 Chr2:168581266..168582300 TCTCAGCAAGTGTCCGTGTC Chr2:168581622..168581641 60.03 55

*** Putative Vector Insertion (Chr 2: 168581265 - 168582301) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679260 Chr2:168580415..168580629 GTGAACCCCAAGGTGTGTCT Chr2:168580528..168580547 59.86 55
downstream ENSMUSE00000708693 Chr2:168579934..168582300 GGGAGCTGTTTTCTCGACTG Chr2:168580116..168580135 59.99 55
downstream ENSMUSE00000709955 Chr2:168579934..168582300 GGGAGCTGTTTTCTCGACTG Chr2:168580116..168580135 59.99 55
downstream ENSMUSE00000232199 Chr2:168577954..168578240 GGCTGTGCTCGGATAAATGT Chr2:168578179..168578198 60.1 50
downstream ENSMUSE00000706061 Chr2:168577954..168578240 GGCTGTGCTCGGATAAATGT Chr2:168578179..168578198 60.1 50
downstream ENSMUSE00000706060 Chr2:168575306..168575960 TAGGATTGCCCAAGGCTATG Chr2:168575343..168575362 60.05 50
downstream ENSMUSE00000661186 Chr2:168573832..168575960 TACCCGCATTAGTCACCACA Chr2:168574996..168575015 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGTGCTCCAGTGAACTCC Chr2:168582282..168582302 60.86 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGTGCTCCAGTGAACTCC Chr2:168582282..168582302 60.86 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027547